Incidental Mutation 'R4522:Tmod2'
ID334270
Institutional Source Beutler Lab
Gene Symbol Tmod2
Ensembl Gene ENSMUSG00000032186
Gene Nametropomodulin 2
SynonymsNTMOD, neural tropomodulin, N-Tmod
MMRRC Submission 041765-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4522 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location75565621-75611325 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75592584 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 129 (T129A)
Ref Sequence ENSEMBL: ENSMUSP00000149584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064433] [ENSMUST00000098552] [ENSMUST00000164100] [ENSMUST00000213565] [ENSMUST00000215036] [ENSMUST00000215462] [ENSMUST00000215614] [ENSMUST00000217233]
Predicted Effect probably benign
Transcript: ENSMUST00000064433
AA Change: T129A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000069956
Gene: ENSMUSG00000032186
AA Change: T129A

DomainStartEndE-ValueType
Pfam:Tropomodulin 1 147 1.7e-68 PFAM
PDB:1IO0|A 163 346 1e-80 PDB
SCOP:d1yrga_ 194 291 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098552
AA Change: T129A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000096152
Gene: ENSMUSG00000032186
AA Change: T129A

DomainStartEndE-ValueType
Pfam:Tropomodulin 1 147 1.7e-68 PFAM
PDB:1IO0|A 163 346 1e-80 PDB
SCOP:d1yrga_ 194 291 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164100
AA Change: T129A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126739
Gene: ENSMUSG00000032186
AA Change: T129A

DomainStartEndE-ValueType
Pfam:Tropomodulin 5 146 6.3e-59 PFAM
PDB:1IO0|A 163 346 1e-80 PDB
SCOP:d1yrga_ 194 291 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213565
AA Change: T129A

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214581
Predicted Effect probably benign
Transcript: ENSMUST00000215036
AA Change: T129A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000215462
AA Change: T129A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000215614
AA Change: T129A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000217233
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a neuronal-specific member of the tropomodulin family of actin-regulatory proteins. The encoded protein caps the pointed end of actin filaments preventing both elongation and depolymerization. The capping activity of this protein is dependent on its association with tropomyosin. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutation of this gene results in enhanced LTP, hyperactivity, impaired startle response, and impaired learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Babam2 G A 5: 32,007,242 V287M probably damaging Het
Brip1 T C 11: 86,189,801 I146M possibly damaging Het
Cacna1b C T 2: 24,654,430 R1248H probably damaging Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Chaf1b G A 16: 93,901,295 A485T probably benign Het
Dock7 T C 4: 98,962,224 R1594G probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Gm3739 T A 14: 7,299,398 K86* probably null Het
Gm7173 A T X: 79,509,995 N291K possibly damaging Het
Mark2 A T 19: 7,285,948 D151E probably damaging Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nwd1 A T 8: 72,670,951 D606V probably damaging Het
Olfr1132 T A 2: 87,635,151 I199L probably benign Het
Pcbp1 T C 6: 86,525,050 N289S probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Ptpn18 T C 1: 34,472,960 L55P probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec23b T A 2: 144,578,366 I450N possibly damaging Het
Speg A G 1: 75,428,330 E2922G probably damaging Het
Spem1 C A 11: 69,821,805 probably null Het
Stxbp3-ps A T 19: 9,559,110 noncoding transcript Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Ttc28 A G 5: 111,280,172 T1845A probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ush2a C T 1: 188,864,625 T3854M probably damaging Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Xdh C A 17: 73,898,344 G1042V probably damaging Het
Zfp105 T A 9: 122,930,056 V264E possibly damaging Het
Other mutations in Tmod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01477:Tmod2 APN 9 75595001 missense probably benign 0.00
IGL02732:Tmod2 APN 9 75586172 missense possibly damaging 0.94
IGL03255:Tmod2 APN 9 75577258 splice site probably benign
PIT4581001:Tmod2 UTSW 9 75597301 missense probably damaging 1.00
R0589:Tmod2 UTSW 9 75576759 missense probably damaging 1.00
R0723:Tmod2 UTSW 9 75595055 missense possibly damaging 0.93
R1721:Tmod2 UTSW 9 75586042 splice site probably benign
R2056:Tmod2 UTSW 9 75577242 missense probably benign 0.00
R2119:Tmod2 UTSW 9 75586095 missense possibly damaging 0.46
R2248:Tmod2 UTSW 9 75592649 missense probably benign 0.03
R4755:Tmod2 UTSW 9 75597212 nonsense probably null
R7149:Tmod2 UTSW 9 75581885 missense possibly damaging 0.52
R7363:Tmod2 UTSW 9 75576741 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATGGGCTAAAACATGGCTTG -3'
(R):5'- GGCGTGTGTCTTAATGCCAG -3'

Sequencing Primer
(F):5'- ATGGCTTGCTCAACCATAGG -3'
(R):5'- GTCTTAATGCCAGCGTTGC -3'
Posted On2015-08-18