Incidental Mutation 'R4522:Zfp105'
ID334271
Institutional Source Beutler Lab
Gene Symbol Zfp105
Ensembl Gene ENSMUSG00000057895
Gene Namezinc finger protein 105
Synonyms
MMRRC Submission 041765-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R4522 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location122923072-122931028 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122930056 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 264 (V264E)
Ref Sequence ENSEMBL: ENSMUSP00000079840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051667] [ENSMUST00000148851]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051667
AA Change: V264E

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079840
Gene: ENSMUSG00000057895
AA Change: V264E

DomainStartEndE-ValueType
ZnF_C2H2 219 241 4.54e-4 SMART
ZnF_C2H2 247 269 1.69e-3 SMART
ZnF_C2H2 275 297 1.2e-3 SMART
ZnF_C2H2 303 325 7.9e-4 SMART
ZnF_C2H2 331 353 7.49e-5 SMART
ZnF_C2H2 359 381 1.82e-3 SMART
ZnF_C2H2 387 409 5.42e-2 SMART
ZnF_C2H2 415 437 2.95e-3 SMART
ZnF_C2H2 443 465 4.79e-3 SMART
ZnF_C2H2 471 493 9.22e-5 SMART
ZnF_C2H2 499 521 1.92e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148851
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele display abnormal spermatogenesis and reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Babam2 G A 5: 32,007,242 V287M probably damaging Het
Brip1 T C 11: 86,189,801 I146M possibly damaging Het
Cacna1b C T 2: 24,654,430 R1248H probably damaging Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Chaf1b G A 16: 93,901,295 A485T probably benign Het
Dock7 T C 4: 98,962,224 R1594G probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Gm3739 T A 14: 7,299,398 K86* probably null Het
Gm7173 A T X: 79,509,995 N291K possibly damaging Het
Mark2 A T 19: 7,285,948 D151E probably damaging Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nwd1 A T 8: 72,670,951 D606V probably damaging Het
Olfr1132 T A 2: 87,635,151 I199L probably benign Het
Pcbp1 T C 6: 86,525,050 N289S probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Ptpn18 T C 1: 34,472,960 L55P probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec23b T A 2: 144,578,366 I450N possibly damaging Het
Speg A G 1: 75,428,330 E2922G probably damaging Het
Spem1 C A 11: 69,821,805 probably null Het
Stxbp3-ps A T 19: 9,559,110 noncoding transcript Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tmod2 T C 9: 75,592,584 T129A probably benign Het
Ttc28 A G 5: 111,280,172 T1845A probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ush2a C T 1: 188,864,625 T3854M probably damaging Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Xdh C A 17: 73,898,344 G1042V probably damaging Het
Other mutations in Zfp105
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1416:Zfp105 UTSW 9 122930677 missense probably damaging 1.00
R1717:Zfp105 UTSW 9 122930631 missense probably damaging 1.00
R2119:Zfp105 UTSW 9 122929678 nonsense probably null
R4953:Zfp105 UTSW 9 122929815 missense probably benign 0.10
R5523:Zfp105 UTSW 9 122926389 missense probably benign 0.00
R6717:Zfp105 UTSW 9 122930308 missense possibly damaging 0.95
R6943:Zfp105 UTSW 9 122925238 missense probably benign
R7102:Zfp105 UTSW 9 122929804 missense probably damaging 1.00
R7827:Zfp105 UTSW 9 122930743 missense probably damaging 1.00
R8065:Zfp105 UTSW 9 122925129 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCTCAGATCTACTCCTGGTAAA -3'
(R):5'- AAAGCTGCACCACACTTTGC -3'

Sequencing Primer
(F):5'- TCAGATCTACTCCTGGTAAAAATCAG -3'
(R):5'- GATAGCTGACTAAAGGCTTTCCC -3'
Posted On2015-08-18