Incidental Mutation 'R4522:Brip1'
ID334273
Institutional Source Beutler Lab
Gene Symbol Brip1
Ensembl Gene ENSMUSG00000034329
Gene NameBRCA1 interacting protein C-terminal helicase 1
Synonyms8030460J03Rik, 3110009N10Rik, BACH1
MMRRC Submission 041765-MU
Accession Numbers

Ncbi RefSeq: NM_178309.2; MGI:2442836

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4522 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location86058138-86201193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86189801 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 146 (I146M)
Ref Sequence ENSEMBL: ENSMUSP00000043108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044423]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044423
AA Change: I146M

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043108
Gene: ENSMUSG00000034329
AA Change: I146M

DomainStartEndE-ValueType
DEXDc 17 520 1.4e-3 SMART
HELICc 701 854 8.2e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121382
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the DEAH subfamily of DEAD box helicases. A similar protein in humans is both a DNA-dependent ATPase and a 5-prime-to-3-prime DNA helicase, and plays a role in the repair of DNA double stranded breaks through interaction with the breast cancer-associated tumor suppressor BRCA1. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit gonadal atrophy, subfertility, germ cell attrition, epithelial tumor predisposition, increased cellular sensitivity to interstrand crosslink-inducing agents, hypersensitivity to replication inhibitors, and predisposition to lymphoma. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Babam2 G A 5: 32,007,242 V287M probably damaging Het
Cacna1b C T 2: 24,654,430 R1248H probably damaging Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Chaf1b G A 16: 93,901,295 A485T probably benign Het
Dock7 T C 4: 98,962,224 R1594G probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Gm3739 T A 14: 7,299,398 K86* probably null Het
Gm7173 A T X: 79,509,995 N291K possibly damaging Het
Mark2 A T 19: 7,285,948 D151E probably damaging Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nwd1 A T 8: 72,670,951 D606V probably damaging Het
Olfr1132 T A 2: 87,635,151 I199L probably benign Het
Pcbp1 T C 6: 86,525,050 N289S probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Ptpn18 T C 1: 34,472,960 L55P probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec23b T A 2: 144,578,366 I450N possibly damaging Het
Speg A G 1: 75,428,330 E2922G probably damaging Het
Spem1 C A 11: 69,821,805 probably null Het
Stxbp3-ps A T 19: 9,559,110 noncoding transcript Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tmod2 T C 9: 75,592,584 T129A probably benign Het
Ttc28 A G 5: 111,280,172 T1845A probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ush2a C T 1: 188,864,625 T3854M probably damaging Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Xdh C A 17: 73,898,344 G1042V probably damaging Het
Zfp105 T A 9: 122,930,056 V264E possibly damaging Het
Other mutations in Brip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Brip1 APN 11 86148401 missense possibly damaging 0.53
IGL01098:Brip1 APN 11 86108862 missense possibly damaging 0.71
IGL01503:Brip1 APN 11 86061877 missense probably benign 0.33
IGL01602:Brip1 APN 11 86062004 missense possibly damaging 0.53
IGL01605:Brip1 APN 11 86062004 missense possibly damaging 0.53
IGL01940:Brip1 APN 11 86064966 missense probably benign 0.00
IGL02019:Brip1 APN 11 86197949 missense possibly damaging 0.73
IGL02212:Brip1 APN 11 86139015 missense possibly damaging 0.86
IGL02456:Brip1 APN 11 86065099 missense possibly damaging 0.71
IGL02727:Brip1 APN 11 86152736 missense probably benign 0.02
IGL02983:Brip1 APN 11 86139124 missense probably benign 0.03
IGL03022:Brip1 APN 11 86077950 missense probably damaging 0.98
IGL03116:Brip1 APN 11 86064909 nonsense probably null
IGL03143:Brip1 APN 11 86061827 missense possibly damaging 0.53
blip UTSW 11 86074298 missense possibly damaging 0.85
radar UTSW 11 86152669 nonsense probably null
P0018:Brip1 UTSW 11 86108868 missense possibly damaging 0.51
R0011:Brip1 UTSW 11 86186998 missense possibly damaging 0.72
R0011:Brip1 UTSW 11 86186998 missense possibly damaging 0.72
R0446:Brip1 UTSW 11 86157601 missense probably damaging 0.98
R0498:Brip1 UTSW 11 86197919 missense possibly damaging 0.96
R0599:Brip1 UTSW 11 86152737 missense probably benign
R0653:Brip1 UTSW 11 86152658 missense possibly damaging 0.85
R0661:Brip1 UTSW 11 86110363 missense possibly damaging 0.86
R0671:Brip1 UTSW 11 86152667 missense possibly damaging 0.93
R0718:Brip1 UTSW 11 86143305 missense possibly damaging 0.96
R0750:Brip1 UTSW 11 86061499 missense possibly damaging 0.53
R0834:Brip1 UTSW 11 86192827 missense probably benign
R1128:Brip1 UTSW 11 86064937 missense possibly damaging 0.86
R1726:Brip1 UTSW 11 86064914 missense probably benign 0.17
R1813:Brip1 UTSW 11 86187080 missense possibly damaging 0.53
R1885:Brip1 UTSW 11 86138815 missense probably damaging 1.00
R1886:Brip1 UTSW 11 86138815 missense probably damaging 1.00
R2093:Brip1 UTSW 11 86139145 missense possibly damaging 0.53
R2206:Brip1 UTSW 11 86061877 missense probably benign 0.33
R2207:Brip1 UTSW 11 86061877 missense probably benign 0.33
R3404:Brip1 UTSW 11 86143263 missense possibly damaging 0.96
R3421:Brip1 UTSW 11 86152669 nonsense probably null
R3876:Brip1 UTSW 11 86152790 missense probably damaging 0.98
R4018:Brip1 UTSW 11 86138851 missense possibly damaging 0.86
R4092:Brip1 UTSW 11 86148521 missense possibly damaging 0.92
R4384:Brip1 UTSW 11 86148429 missense possibly damaging 0.70
R4394:Brip1 UTSW 11 86074298 missense possibly damaging 0.85
R4518:Brip1 UTSW 11 86077878 missense possibly damaging 0.92
R4840:Brip1 UTSW 11 86146183 missense possibly damaging 0.86
R5025:Brip1 UTSW 11 86064980 missense probably benign 0.04
R5176:Brip1 UTSW 11 86077884 missense probably damaging 0.98
R5213:Brip1 UTSW 11 86143321 missense possibly damaging 0.73
R5470:Brip1 UTSW 11 86148542 missense possibly damaging 0.71
R5525:Brip1 UTSW 11 86110447 missense possibly damaging 0.85
R6057:Brip1 UTSW 11 86065039 missense possibly damaging 0.73
R6819:Brip1 UTSW 11 86110441 missense possibly damaging 0.51
R6908:Brip1 UTSW 11 86077884 missense probably damaging 0.98
R6920:Brip1 UTSW 11 86148536 nonsense probably null
R7053:Brip1 UTSW 11 86192965 missense possibly damaging 0.53
R7235:Brip1 UTSW 11 86138875 missense possibly damaging 0.53
R7253:Brip1 UTSW 11 86143278 missense possibly damaging 0.96
R7347:Brip1 UTSW 11 86139103 missense probably benign 0.34
R7476:Brip1 UTSW 11 86157808 missense probably benign 0.33
R7580:Brip1 UTSW 11 86157601 missense probably damaging 0.98
R7639:Brip1 UTSW 11 86152822 splice site probably null
R7771:Brip1 UTSW 11 86062024 missense probably benign 0.02
R8125:Brip1 UTSW 11 86186991 missense possibly damaging 0.73
R8236:Brip1 UTSW 11 86139112 missense probably damaging 0.98
R8509:Brip1 UTSW 11 86197948 nonsense probably null
X0060:Brip1 UTSW 11 86152619 missense possibly damaging 0.71
X0062:Brip1 UTSW 11 86143356 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- CACCACACAGTTGCTTTGAC -3'
(R):5'- GGAAAGACAAATTGGCAGTTTCTTG -3'

Sequencing Primer
(F):5'- CCACACAGTTGCTTTGACTATTTTAG -3'
(R):5'- TGTCTCAATCAGCCAATGGG -3'
Posted On2015-08-18