Mutagenetix > Incidental Mutations

Incidental Mutation 'R4522:Chaf1b'

334277

Institutional Source

Beutler Lab

Gene Symbol

Chaf1b

Ensembl Gene

ENSMUSG00000022945

Gene Name

chromatin assembly factor 1, subunit B (p60)

Synonyms

2600017H24Rik, CAF1P60, CAF1A, MPHOSPH7, CAF1, CAF-I 60 kDa subunit, CAF-IP60, CAF-1 subunit B

MMRRC Submission

041765-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.943) question?

Stock #

R4522 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

93883901-93906115 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 93901295 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 485 (A485T)

Ref Sequence

ENSEMBL: ENSMUSP00000113684 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023666] [ENSMUST00000117099] [ENSMUST00000143006]

Predicted Effect

probably benign
Transcript: ENSMUST00000023666
AA Change: A485T

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000023666
Gene: ENSMUSG00000022945
AA Change: A485T

Domain	Start	End	E-Value	Type
WD40	3	45	4.95e0	SMART
WD40	55	94	4.44e-6	SMART
WD40	118	157	3.78e-9	SMART
WD40	160	199	5.86e-6	SMART
Blast:WD40	219	258	5e-10	BLAST
WD40	274	338	2.84e2	SMART
WD40	344	381	5.13e0	SMART
Pfam:CAF-1_p60_C	388	564	2e-75	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000117099
AA Change: A485T

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000113684
Gene: ENSMUSG00000022945
AA Change: A485T

Domain	Start	End	E-Value	Type
WD40	3	45	4.95e0	SMART
WD40	55	94	4.44e-6	SMART
WD40	118	157	3.78e-9	SMART
WD40	160	199	5.86e-6	SMART
Blast:WD40	219	258	5e-10	BLAST
WD40	274	338	2.84e2	SMART
WD40	344	381	5.13e0	SMART
Pfam:CAF-1_p60_C	388	561	6.3e-69	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128316

Predicted Effect

probably benign
Transcript: ENSMUST00000143006

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chromatin assembly factor I (CAF-I) is required for the assembly of histone octamers onto newly-replicated DNA. CAF-I is composed of three protein subunits, p50, p60, and p150. The protein encoded by this gene corresponds to the p60 subunit and is required for chromatin assembly after replication. The encoded protein is differentially phosphorylated in a cell cycle-dependent manner. In addition, it is normally found in the nucleus except during mitosis, when it is released into the cytoplasm. This protein is a member of the WD-repeat HIR1 family and may also be involved in DNA repair. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ascc3	A	G	10: 50,660,670	N700D	probably benign	Het
Babam2	G	A	5: 32,007,242	V287M	probably damaging	Het
Brip1	T	C	11: 86,189,801	I146M	possibly damaging	Het
Cacna1b	C	T	2: 24,654,430	R1248H	probably damaging	Het
Ccdc88c	G	T	12: 100,913,332	S1843R	possibly damaging	Het
Dock7	T	C	4: 98,962,224	R1594G	probably damaging	Het
Fam122c	G	A	X: 53,293,499	R94H	possibly damaging	Het
Fbxo41	A	G	6: 85,484,042	I228T	probably damaging	Het
Gm3739	T	A	14: 7,299,398	K86*	probably null	Het
Gm7173	A	T	X: 79,509,995	N291K	possibly damaging	Het
Mark2	A	T	19: 7,285,948	D151E	probably damaging	Het
Nop2	G	T	6: 125,133,552	R47L	probably damaging	Het
Nwd1	A	T	8: 72,670,951	D606V	probably damaging	Het
Olfr1132	T	A	2: 87,635,151	I199L	probably benign	Het
Pcbp1	T	C	6: 86,525,050	N289S	probably benign	Het
Plce1	T	C	19: 38,524,319	S21P	possibly damaging	Het
Ptpn18	T	C	1: 34,472,960	L55P	probably benign	Het
Rpl10l	T	C	12: 66,283,738	D207G	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sec23b	T	A	2: 144,578,366	I450N	possibly damaging	Het
Speg	A	G	1: 75,428,330	E2922G	probably damaging	Het
Spem1	C	A	11: 69,821,805		probably null	Het
Stxbp3-ps	A	T	19: 9,559,110		noncoding transcript	Het
Tmem38a	C	T	8: 72,572,161	P20S	possibly damaging	Het
Tmod2	T	C	9: 75,592,584	T129A	probably benign	Het
Ttc28	A	G	5: 111,280,172	T1845A	probably benign	Het
Ubqlnl	C	T	7: 104,149,718	V191M	probably benign	Het
Ush2a	C	T	1: 188,864,625	T3854M	probably damaging	Het
Vmn2r72	T	A	7: 85,751,926	H95L	probably benign	Het
Xdh	C	A	17: 73,898,344	G1042V	probably damaging	Het
Zfp105	T	A	9: 122,930,056	V264E	possibly damaging	Het

Other mutations in Chaf1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00562:Chaf1b	APN	16	93900191	unclassified	probably benign
R0090:Chaf1b	UTSW	16	93887124	missense	possibly damaging	0.52
R0309:Chaf1b	UTSW	16	93884511	missense	probably damaging	0.96
R0690:Chaf1b	UTSW	16	93900017	splice site	probably benign
R1494:Chaf1b	UTSW	16	93888110	missense	probably damaging	1.00
R1572:Chaf1b	UTSW	16	93901230	missense	possibly damaging	0.77
R1595:Chaf1b	UTSW	16	93905099	critical splice donor site	probably null
R1654:Chaf1b	UTSW	16	93894903	missense	probably damaging	0.97
R2057:Chaf1b	UTSW	16	93894907	missense	probably damaging	1.00
R2280:Chaf1b	UTSW	16	93891571	missense	probably damaging	1.00
R2406:Chaf1b	UTSW	16	93900155	missense	probably damaging	0.99
R2655:Chaf1b	UTSW	16	93891511	missense	probably damaging	0.99
R4605:Chaf1b	UTSW	16	93888089	missense	possibly damaging	0.90
R4686:Chaf1b	UTSW	16	93884584	missense	probably benign	0.00
R4784:Chaf1b	UTSW	16	93884542	missense	probably damaging	1.00
R4862:Chaf1b	UTSW	16	93887134	missense	probably damaging	0.99
R5603:Chaf1b	UTSW	16	93892795	missense	probably damaging	1.00
R5683:Chaf1b	UTSW	16	93887142	missense	possibly damaging	0.90
R6763:Chaf1b	UTSW	16	93891505	missense	probably damaging	1.00
R6940:Chaf1b	UTSW	16	93905965	missense	probably benign	0.00
R7401:Chaf1b	UTSW	16	93884380	start gained	probably benign
R7862:Chaf1b	UTSW	16	93888095	missense	possibly damaging	0.90
R7980:Chaf1b	UTSW	16	93884527	missense	probably damaging	1.00
R8083:Chaf1b	UTSW	16	93894742	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CAGACACACCAGGGATCTTC -3'
(R):5'- ACGGGAAGATGCTAGGCTTC -3'

Sequencing Primer
(F):5'- ATCTTCGCCGGGATCCAGATC -3'
(R):5'- CTTCATCCCTAGGCAGGAATGTAG -3'

Posted On

2015-08-18