Incidental Mutation 'R4522:Chaf1b'
ID334277
Institutional Source Beutler Lab
Gene Symbol Chaf1b
Ensembl Gene ENSMUSG00000022945
Gene Namechromatin assembly factor 1, subunit B (p60)
Synonyms2600017H24Rik, CAF1P60, CAF1A, MPHOSPH7, CAF1, CAF-I 60 kDa subunit, CAF-IP60, CAF-1 subunit B
MMRRC Submission 041765-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R4522 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location93883901-93906115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 93901295 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 485 (A485T)
Ref Sequence ENSEMBL: ENSMUSP00000113684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023666] [ENSMUST00000117099] [ENSMUST00000143006]
Predicted Effect probably benign
Transcript: ENSMUST00000023666
AA Change: A485T

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000023666
Gene: ENSMUSG00000022945
AA Change: A485T

DomainStartEndE-ValueType
WD40 3 45 4.95e0 SMART
WD40 55 94 4.44e-6 SMART
WD40 118 157 3.78e-9 SMART
WD40 160 199 5.86e-6 SMART
Blast:WD40 219 258 5e-10 BLAST
WD40 274 338 2.84e2 SMART
WD40 344 381 5.13e0 SMART
Pfam:CAF-1_p60_C 388 564 2e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117099
AA Change: A485T

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000113684
Gene: ENSMUSG00000022945
AA Change: A485T

DomainStartEndE-ValueType
WD40 3 45 4.95e0 SMART
WD40 55 94 4.44e-6 SMART
WD40 118 157 3.78e-9 SMART
WD40 160 199 5.86e-6 SMART
Blast:WD40 219 258 5e-10 BLAST
WD40 274 338 2.84e2 SMART
WD40 344 381 5.13e0 SMART
Pfam:CAF-1_p60_C 388 561 6.3e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128316
Predicted Effect probably benign
Transcript: ENSMUST00000143006
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chromatin assembly factor I (CAF-I) is required for the assembly of histone octamers onto newly-replicated DNA. CAF-I is composed of three protein subunits, p50, p60, and p150. The protein encoded by this gene corresponds to the p60 subunit and is required for chromatin assembly after replication. The encoded protein is differentially phosphorylated in a cell cycle-dependent manner. In addition, it is normally found in the nucleus except during mitosis, when it is released into the cytoplasm. This protein is a member of the WD-repeat HIR1 family and may also be involved in DNA repair. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Babam2 G A 5: 32,007,242 V287M probably damaging Het
Brip1 T C 11: 86,189,801 I146M possibly damaging Het
Cacna1b C T 2: 24,654,430 R1248H probably damaging Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Dock7 T C 4: 98,962,224 R1594G probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Gm3739 T A 14: 7,299,398 K86* probably null Het
Gm7173 A T X: 79,509,995 N291K possibly damaging Het
Mark2 A T 19: 7,285,948 D151E probably damaging Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nwd1 A T 8: 72,670,951 D606V probably damaging Het
Olfr1132 T A 2: 87,635,151 I199L probably benign Het
Pcbp1 T C 6: 86,525,050 N289S probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Ptpn18 T C 1: 34,472,960 L55P probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec23b T A 2: 144,578,366 I450N possibly damaging Het
Speg A G 1: 75,428,330 E2922G probably damaging Het
Spem1 C A 11: 69,821,805 probably null Het
Stxbp3-ps A T 19: 9,559,110 noncoding transcript Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tmod2 T C 9: 75,592,584 T129A probably benign Het
Ttc28 A G 5: 111,280,172 T1845A probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ush2a C T 1: 188,864,625 T3854M probably damaging Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Xdh C A 17: 73,898,344 G1042V probably damaging Het
Zfp105 T A 9: 122,930,056 V264E possibly damaging Het
Other mutations in Chaf1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Chaf1b APN 16 93900191 unclassified probably benign
R0090:Chaf1b UTSW 16 93887124 missense possibly damaging 0.52
R0309:Chaf1b UTSW 16 93884511 missense probably damaging 0.96
R0690:Chaf1b UTSW 16 93900017 splice site probably benign
R1494:Chaf1b UTSW 16 93888110 missense probably damaging 1.00
R1572:Chaf1b UTSW 16 93901230 missense possibly damaging 0.77
R1595:Chaf1b UTSW 16 93905099 critical splice donor site probably null
R1654:Chaf1b UTSW 16 93894903 missense probably damaging 0.97
R2057:Chaf1b UTSW 16 93894907 missense probably damaging 1.00
R2280:Chaf1b UTSW 16 93891571 missense probably damaging 1.00
R2406:Chaf1b UTSW 16 93900155 missense probably damaging 0.99
R2655:Chaf1b UTSW 16 93891511 missense probably damaging 0.99
R4605:Chaf1b UTSW 16 93888089 missense possibly damaging 0.90
R4686:Chaf1b UTSW 16 93884584 missense probably benign 0.00
R4784:Chaf1b UTSW 16 93884542 missense probably damaging 1.00
R4862:Chaf1b UTSW 16 93887134 missense probably damaging 0.99
R5603:Chaf1b UTSW 16 93892795 missense probably damaging 1.00
R5683:Chaf1b UTSW 16 93887142 missense possibly damaging 0.90
R6763:Chaf1b UTSW 16 93891505 missense probably damaging 1.00
R6940:Chaf1b UTSW 16 93905965 missense probably benign 0.00
R7401:Chaf1b UTSW 16 93884380 start gained probably benign
R7862:Chaf1b UTSW 16 93888095 missense possibly damaging 0.90
R7980:Chaf1b UTSW 16 93884527 missense probably damaging 1.00
R8083:Chaf1b UTSW 16 93894742 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAGACACACCAGGGATCTTC -3'
(R):5'- ACGGGAAGATGCTAGGCTTC -3'

Sequencing Primer
(F):5'- ATCTTCGCCGGGATCCAGATC -3'
(R):5'- CTTCATCCCTAGGCAGGAATGTAG -3'
Posted On2015-08-18