Incidental Mutation 'R0207:Adamts10'
ID33428
Institutional Source Beutler Lab
Gene Symbol Adamts10
Ensembl Gene ENSMUSG00000024299
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 10
SynonymsZnMP
MMRRC Submission 038460-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.292) question?
Stock #R0207 (G1)
Quality Score209
Status Validated
Chromosome17
Chromosomal Location33524204-33553782 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 33545390 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 663 (P663T)
Ref Sequence ENSEMBL: ENSMUSP00000084905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087623] [ENSMUST00000172922] [ENSMUST00000173013] [ENSMUST00000173030] [ENSMUST00000173241] [ENSMUST00000173931]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087623
AA Change: P663T

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000084905
Gene: ENSMUSG00000024299
AA Change: P663T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 40 180 1.3e-33 PFAM
Pfam:Reprolysin_5 237 432 5e-15 PFAM
Pfam:Reprolysin_4 237 448 5e-11 PFAM
Pfam:Reprolysin 239 457 1.6e-25 PFAM
Pfam:Reprolysin_2 257 447 1.2e-13 PFAM
Pfam:Reprolysin_3 261 403 5.7e-13 PFAM
TSP1 550 602 7.21e-11 SMART
Pfam:ADAM_spacer1 706 818 1.3e-27 PFAM
TSP1 828 885 4.73e-6 SMART
TSP1 887 940 4.35e-2 SMART
TSP1 948 1003 2.66e-2 SMART
TSP1 1006 1058 9.98e-5 SMART
Pfam:PLAC 1070 1102 8.4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172922
SMART Domains Protein: ENSMUSP00000133891
Gene: ENSMUSG00000024299

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 180 1.1e-30 PFAM
SCOP:d1bkca_ 238 271 4e-7 SMART
low complexity region 285 296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173013
SMART Domains Protein: ENSMUSP00000134181
Gene: ENSMUSG00000024299

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 180 9.6e-31 PFAM
SCOP:d1bkca_ 238 271 3e-7 SMART
low complexity region 285 296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173030
SMART Domains Protein: ENSMUSP00000134549
Gene: ENSMUSG00000024299

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 180 9.6e-31 PFAM
SCOP:d1bkca_ 238 271 3e-7 SMART
low complexity region 285 296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173241
SMART Domains Protein: ENSMUSP00000134298
Gene: ENSMUSG00000024299

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 180 9.6e-31 PFAM
SCOP:d1bkca_ 238 271 3e-7 SMART
low complexity region 285 296 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173813
Predicted Effect probably benign
Transcript: ENSMUST00000173931
SMART Domains Protein: ENSMUSP00000133434
Gene: ENSMUSG00000024299

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 180 9.6e-31 PFAM
SCOP:d1bkca_ 238 271 3e-7 SMART
low complexity region 285 296 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174104
Predicted Effect probably benign
Transcript: ENSMUST00000174348
SMART Domains Protein: ENSMUSP00000133856
Gene: ENSMUSG00000024299

DomainStartEndE-ValueType
Pfam:Reprolysin_5 23 220 2.6e-16 PFAM
Pfam:Reprolysin_4 23 235 2.6e-12 PFAM
Pfam:Reprolysin 25 243 1e-26 PFAM
Pfam:Reprolysin_2 43 233 7.1e-15 PFAM
Pfam:Reprolysin_3 47 189 4.7e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174666
Meta Mutation Damage Score 0.1603 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.5%
Validation Efficiency 95% (76/80)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate a functional, zinc-dependent metallopeptidase enzyme. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,086,039 F488S probably damaging Het
Acap3 C T 4: 155,899,424 R116W probably damaging Het
Akap12 G A 10: 4,353,333 G48S probably damaging Het
Ankrd7 T A 6: 18,870,031 M261K probably benign Het
Ankzf1 C A 1: 75,198,304 D599E possibly damaging Het
Aox1 T C 1: 58,105,014 I1278T possibly damaging Het
Apcdd1 T C 18: 62,950,079 Y327H probably benign Het
Asxl3 T A 18: 22,411,496 probably benign Het
Birc6 C A 17: 74,662,832 probably benign Het
Btaf1 T A 19: 37,009,648 L1714* probably null Het
Cacng6 T A 7: 3,425,004 probably benign Het
Cdc20b A G 13: 113,078,612 D238G probably damaging Het
Celf5 T A 10: 81,470,698 R113W probably null Het
Cfap70 C A 14: 20,412,347 E659D probably damaging Het
Clspn T A 4: 126,590,598 M1183K possibly damaging Het
Dpy19l1 G A 9: 24,453,891 R275C probably damaging Het
Dst C T 1: 34,186,935 S1721L probably benign Het
Faap100 T C 11: 120,374,365 T562A probably damaging Het
Fam168b T C 1: 34,819,688 M133V probably damaging Het
Farp2 T C 1: 93,569,087 I172T probably damaging Het
Fer T G 17: 63,896,278 S68A probably damaging Het
Fmo5 A G 3: 97,645,681 E315G probably damaging Het
Gpr89 A T 3: 96,871,480 F426I probably damaging Het
Hinfp T C 9: 44,296,327 I461V possibly damaging Het
Hsd11b1 A T 1: 193,240,248 V167D probably damaging Het
Htt A G 5: 34,896,908 K2574E probably benign Het
I830077J02Rik A G 3: 105,926,505 S112P probably benign Het
Igf2bp3 T A 6: 49,105,617 M344L probably benign Het
Itch A T 2: 155,202,257 Q494L probably benign Het
Itga9 T C 9: 118,769,253 probably benign Het
Jaml T A 9: 45,093,767 D152E probably benign Het
Kif22 A C 7: 127,042,400 M1R probably null Het
Kifap3 T C 1: 163,883,386 Y663H probably benign Het
Letm2 T A 8: 25,578,770 N472I probably damaging Het
Mthfr T G 4: 148,052,224 V446G probably damaging Het
Myh11 T C 16: 14,211,260 E1206G possibly damaging Het
Myo6 G A 9: 80,288,056 V903I probably damaging Het
Myo9b C T 8: 71,355,225 probably benign Het
Nr2f2 G C 7: 70,360,175 P52R probably damaging Het
Nsd3 A G 8: 25,683,257 N859S probably benign Het
Nucb2 C A 7: 116,536,010 A384E probably damaging Het
Ogdhl C A 14: 32,342,037 probably null Het
Olfr119 C A 17: 37,701,058 C129* probably null Het
Olfr1247 G A 2: 89,609,863 L80F probably damaging Het
Olfr1357 T C 10: 78,611,871 T257A probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr381 A T 11: 73,486,575 L83Q probably benign Het
Parp10 C T 15: 76,242,633 S145N probably benign Het
Pigh A G 12: 79,083,709 probably benign Het
Pigo A G 4: 43,023,824 probably benign Het
Pkp4 T A 2: 59,305,488 V199D possibly damaging Het
Polr1e C A 4: 45,025,143 probably null Het
Ppfia3 C A 7: 45,348,534 R723L probably damaging Het
Prex1 C A 2: 166,585,898 A945S possibly damaging Het
Prrt3 A T 6: 113,495,840 V457E probably damaging Het
Rab39 A G 9: 53,705,971 F49L possibly damaging Het
Rrs1 C A 1: 9,545,762 probably null Het
Rrs1 G A 1: 9,545,767 E82K probably damaging Het
Serpinb3c T C 1: 107,276,992 D8G probably benign Het
Slc17a6 A G 7: 51,646,180 probably benign Het
Slc24a4 T A 12: 102,228,951 probably null Het
Smc1b C T 15: 85,123,759 M272I probably benign Het
Smc6 T C 12: 11,283,178 probably benign Het
Tcf20 T C 15: 82,855,085 T722A probably benign Het
Tesmin A T 19: 3,404,088 M141L probably benign Het
Tmprss5 T A 9: 49,113,160 H274Q possibly damaging Het
Tns1 C T 1: 73,937,318 probably null Het
Tpr T C 1: 150,417,427 S868P possibly damaging Het
Trank1 C T 9: 111,366,253 T1115I probably damaging Het
Trmt44 A T 5: 35,572,917 I203K possibly damaging Het
Ulk2 A T 11: 61,777,785 V1037E probably benign Het
Usp43 A G 11: 67,876,499 Y682H probably damaging Het
Vipr2 A T 12: 116,142,882 Q366L probably damaging Het
Vmn1r185 C A 7: 26,611,589 V164L possibly damaging Het
Vmn2r120 C T 17: 57,525,052 V246I probably benign Het
Wdr66 T C 5: 123,283,447 V182A probably damaging Het
Wiz C T 17: 32,357,033 G790R probably damaging Het
Wnk1 A T 6: 119,952,733 S1016R probably damaging Het
Zc3hav1 A G 6: 38,311,174 L909S probably benign Het
Zfp236 T A 18: 82,640,227 I637F probably damaging Het
Zfp788 G A 7: 41,649,596 G532D probably damaging Het
Zranb1 T C 7: 132,950,385 I255T probably damaging Het
Other mutations in Adamts10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01541:Adamts10 APN 17 33543231 missense probably benign 0.24
IGL01865:Adamts10 APN 17 33553166 missense probably damaging 0.99
IGL02391:Adamts10 APN 17 33528811 missense probably benign 0.00
IGL02711:Adamts10 APN 17 33538272 missense probably damaging 0.99
R0122:Adamts10 UTSW 17 33528480 unclassified probably benign
R0481:Adamts10 UTSW 17 33549373 nonsense probably null
R0508:Adamts10 UTSW 17 33543718 missense probably damaging 1.00
R0558:Adamts10 UTSW 17 33550609 missense probably benign 0.04
R0746:Adamts10 UTSW 17 33549547 nonsense probably null
R1027:Adamts10 UTSW 17 33543763 missense probably benign 0.44
R1449:Adamts10 UTSW 17 33545639 missense probably damaging 0.96
R1471:Adamts10 UTSW 17 33553138 missense probably damaging 1.00
R1522:Adamts10 UTSW 17 33537319 missense probably benign 0.40
R1631:Adamts10 UTSW 17 33537342 missense probably benign 0.25
R1863:Adamts10 UTSW 17 33551432 critical splice donor site probably null
R1913:Adamts10 UTSW 17 33549555 missense probably benign 0.00
R2091:Adamts10 UTSW 17 33551192 critical splice donor site probably null
R2377:Adamts10 UTSW 17 33528892 missense probably damaging 1.00
R3743:Adamts10 UTSW 17 33528712 missense probably damaging 1.00
R4042:Adamts10 UTSW 17 33549540 missense possibly damaging 0.69
R4646:Adamts10 UTSW 17 33545555 missense probably damaging 1.00
R4654:Adamts10 UTSW 17 33537330 missense possibly damaging 0.89
R4695:Adamts10 UTSW 17 33531739 missense possibly damaging 0.95
R4721:Adamts10 UTSW 17 33545537 splice site probably null
R4798:Adamts10 UTSW 17 33528752 missense probably damaging 1.00
R4896:Adamts10 UTSW 17 33528896 missense possibly damaging 0.90
R7454:Adamts10 UTSW 17 33545005 missense possibly damaging 0.89
R7494:Adamts10 UTSW 17 33549378 nonsense probably null
R7541:Adamts10 UTSW 17 33531616 missense probably benign 0.00
R7704:Adamts10 UTSW 17 33551152 missense probably damaging 1.00
Z1176:Adamts10 UTSW 17 33528787 missense probably damaging 1.00
Z1176:Adamts10 UTSW 17 33528788 missense probably damaging 1.00
Z1177:Adamts10 UTSW 17 33545429 missense possibly damaging 0.76
Z1177:Adamts10 UTSW 17 33545594 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGAAACTTCGCTGTTCCCTCTGAC -3'
(R):5'- AGCTGGGCTAAAGACACCTTCAATG -3'

Sequencing Primer
(F):5'- ACCTGGCTCCAAGTCTGATG -3'
(R):5'- TGTCCTCTCGGAGATCAGAAC -3'
Posted On2013-05-09