Incidental Mutation 'R4522:Fam122c'
ID334282
Institutional Source Beutler Lab
Gene Symbol Fam122c
Ensembl Gene ENSMUSG00000036013
Gene Namefamily with sequence similarity 122, member C
Synonyms
MMRRC Submission 041765-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4522 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location53273424-53331185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 53293499 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 94 (R94H)
Ref Sequence ENSEMBL: ENSMUSP00000139776 (fasta)
Predicted Effect possibly damaging
Transcript: ENSMUST00000114835
AA Change: R94H

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000124137
AA Change: R94H

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000186314
AA Change: R94H

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Babam2 G A 5: 32,007,242 V287M probably damaging Het
Brip1 T C 11: 86,189,801 I146M possibly damaging Het
Cacna1b C T 2: 24,654,430 R1248H probably damaging Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Chaf1b G A 16: 93,901,295 A485T probably benign Het
Dock7 T C 4: 98,962,224 R1594G probably damaging Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Gm3739 T A 14: 7,299,398 K86* probably null Het
Gm7173 A T X: 79,509,995 N291K possibly damaging Het
Mark2 A T 19: 7,285,948 D151E probably damaging Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nwd1 A T 8: 72,670,951 D606V probably damaging Het
Olfr1132 T A 2: 87,635,151 I199L probably benign Het
Pcbp1 T C 6: 86,525,050 N289S probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Ptpn18 T C 1: 34,472,960 L55P probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec23b T A 2: 144,578,366 I450N possibly damaging Het
Speg A G 1: 75,428,330 E2922G probably damaging Het
Spem1 C A 11: 69,821,805 probably null Het
Stxbp3-ps A T 19: 9,559,110 noncoding transcript Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tmod2 T C 9: 75,592,584 T129A probably benign Het
Ttc28 A G 5: 111,280,172 T1845A probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ush2a C T 1: 188,864,625 T3854M probably damaging Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Xdh C A 17: 73,898,344 G1042V probably damaging Het
Zfp105 T A 9: 122,930,056 V264E possibly damaging Het
Other mutations in Fam122c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4198:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4199:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4361:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4515:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4517:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4518:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4519:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4523:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4529:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4530:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4532:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4533:Fam122c UTSW X 53293499 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CATTGCTGCTGTACACTCAATAAG -3'
(R):5'- TGTAATCGGCTATGACTGCTTTTAG -3'

Sequencing Primer
(F):5'- GAATCAGGGTTTCTCTGTATAGCCC -3'
(R):5'- AAGCCTCCTGATGATGACCTG -3'
Posted On2015-08-18