Incidental Mutation 'R4523:Optc'
ID334285
Institutional Source Beutler Lab
Gene Symbol Optc
Ensembl Gene ENSMUSG00000010311
Gene Nameopticin
Synonyms
MMRRC Submission 042004-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4523 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location133897199-133907999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 133903754 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 138 (T138K)
Ref Sequence ENSEMBL: ENSMUSP00000123262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124051] [ENSMUST00000149380] [ENSMUST00000153617]
Predicted Effect possibly damaging
Transcript: ENSMUST00000124051
AA Change: T138K

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120568
Gene: ENSMUSG00000010311
AA Change: T138K

DomainStartEndE-ValueType
low complexity region 42 70 N/A INTRINSIC
low complexity region 78 88 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
LRRNT 176 206 2.22e-2 SMART
LRR 200 224 3.55e1 SMART
LRR_TYP 225 248 6.78e-3 SMART
LRR 249 271 4.21e1 SMART
LRR 295 318 1.76e1 SMART
LRR 319 339 3.36e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124245
Predicted Effect unknown
Transcript: ENSMUST00000126123
AA Change: T127K
SMART Domains Protein: ENSMUSP00000117086
Gene: ENSMUSG00000010311
AA Change: T127K

DomainStartEndE-ValueType
low complexity region 32 60 N/A INTRINSIC
low complexity region 68 78 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
LRRNT 166 196 2.22e-2 SMART
LRR 190 214 3.55e1 SMART
LRR_TYP 215 238 6.78e-3 SMART
LRR 239 261 4.21e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000149380
AA Change: T138K

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115661
Gene: ENSMUSG00000010311
AA Change: T138K

DomainStartEndE-ValueType
low complexity region 42 70 N/A INTRINSIC
low complexity region 78 88 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
LRR 173 195 1.22e1 SMART
LRR 196 218 4.21e1 SMART
LRR 242 265 1.76e1 SMART
LRR 266 286 3.36e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000153617
AA Change: T138K

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123262
Gene: ENSMUSG00000010311
AA Change: T138K

DomainStartEndE-ValueType
low complexity region 42 70 N/A INTRINSIC
low complexity region 78 88 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
LRR 173 195 1.22e1 SMART
LRR 196 218 4.21e1 SMART
LRR 242 265 1.76e1 SMART
LRR 266 286 3.36e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160564
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Opticin belongs to class III of the small leucine-rich repeat protein (SLRP) family. Members of this family are typically associated with the extracellular matrix. Opticin is present in significant quantities in the vitreous of the eye and also localizes to the cornea, iris, ciliary body, optic nerve, choroid, retina, and fetal liver. Opticin may noncovalently bind collagen fibrils and regulate fibril morphology, spacing, and organization. The opticin gene is mapped to a region of chromosome 1 that is associated with the inherited eye diseases age-related macular degeneration (AMD) and posterior column ataxia with retinosa pigmentosa (AXPC1). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased preretinal neovascularization in an oxygen-induced retinopathy model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8a1 G T 5: 67,667,600 T796K probably benign Het
Atr T C 9: 95,862,863 S78P probably damaging Het
BC017643 A G 11: 121,224,108 probably benign Het
Calb2 C T 8: 110,148,509 probably null Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cdca7 A G 2: 72,479,698 S77G probably damaging Het
Cnot2 C T 10: 116,581,474 probably benign Het
Cstf2t T A 19: 31,083,082 V6D possibly damaging Het
Dido1 T C 2: 180,672,292 I852V probably damaging Het
Dmgdh C T 13: 93,688,630 Q154* probably null Het
Dnah12 T C 14: 26,770,022 F1138S probably damaging Het
Dnah12 G A 14: 26,876,958 A998T possibly damaging Het
Dusp5 T G 19: 53,537,601 Y225D probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam126a T C 5: 23,965,122 T410A probably benign Het
Fam193a G A 5: 34,443,371 D601N probably benign Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Fmo2 T C 1: 162,887,708 K115R probably benign Het
Gak G T 5: 108,576,566 Q1093K probably benign Het
Gm5277 G T 3: 78,892,186 noncoding transcript Het
Gm7173 A T X: 79,509,995 N291K possibly damaging Het
Hgsnat A G 8: 25,968,361 probably null Het
Map3k3 G A 11: 106,148,868 R278H probably damaging Het
Mrvi1 T C 7: 110,923,841 M338V probably benign Het
Muc4 T C 16: 32,736,336 probably benign Het
Nectin3 C A 16: 46,448,590 R483L probably benign Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Ntng1 A G 3: 109,934,996 S154P probably damaging Het
Olfml2b T C 1: 170,669,222 I474T probably benign Het
Olfr1054 C G 2: 86,333,300 D19H probably benign Het
Olfr843 T C 9: 19,249,229 T57A probably damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pard3 C T 8: 127,398,627 P421S probably benign Het
Pcdhb22 G T 18: 37,520,421 E647D probably benign Het
Pclo A G 5: 14,679,992 probably benign Het
Prkce G T 17: 86,490,750 probably null Het
Prr12 T C 7: 45,048,523 D656G unknown Het
Ptprk A T 10: 28,466,052 D485V probably damaging Het
Ptprn2 T C 12: 116,876,000 L381P probably damaging Het
Rnf144b T C 13: 47,207,537 I51T probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Sh3glb2 A T 2: 30,350,699 V118E probably damaging Het
Sipa1l2 C T 8: 125,492,424 G58D probably damaging Het
Slc5a4a C T 10: 76,148,362 A46V probably damaging Het
Tepp T A 8: 95,313,010 Y18* probably null Het
Tgm7 C A 2: 121,098,588 probably null Het
Tjap1 A G 17: 46,258,792 V424A probably benign Het
Trpm6 A T 19: 18,796,500 I414F probably damaging Het
Tsr3 C G 17: 25,241,749 D196E probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Vmn2r97 T A 17: 18,929,071 N240K probably benign Het
Xdh C A 17: 73,898,344 G1042V probably damaging Het
Zcchc4 A G 5: 52,784,067 D68G probably damaging Het
Other mutations in Optc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Optc APN 1 133902108 missense probably damaging 1.00
IGL01900:Optc APN 1 133902129 missense possibly damaging 0.68
IGL01988:Optc APN 1 133906929 critical splice donor site probably null
IGL02070:Optc APN 1 133901176 missense probably damaging 1.00
IGL02859:Optc APN 1 133902061 missense probably damaging 1.00
IGL03166:Optc APN 1 133903792 splice site probably benign
R0826:Optc UTSW 1 133905155 missense probably benign 0.07
R1728:Optc UTSW 1 133903796 splice site probably null
R1728:Optc UTSW 1 133905170 missense probably benign
R1729:Optc UTSW 1 133903796 splice site probably null
R1729:Optc UTSW 1 133905170 missense probably benign
R1730:Optc UTSW 1 133903796 splice site probably null
R1730:Optc UTSW 1 133905170 missense probably benign
R1739:Optc UTSW 1 133903796 splice site probably null
R1739:Optc UTSW 1 133905170 missense probably benign
R1762:Optc UTSW 1 133903796 splice site probably null
R1762:Optc UTSW 1 133905170 missense probably benign
R1783:Optc UTSW 1 133903796 splice site probably null
R1783:Optc UTSW 1 133905170 missense probably benign
R1784:Optc UTSW 1 133903796 splice site probably null
R1784:Optc UTSW 1 133905170 missense probably benign
R1785:Optc UTSW 1 133903796 splice site probably null
R1785:Optc UTSW 1 133905170 missense probably benign
R2049:Optc UTSW 1 133903796 splice site probably null
R2130:Optc UTSW 1 133903796 splice site probably null
R2131:Optc UTSW 1 133903796 splice site probably null
R2133:Optc UTSW 1 133903796 splice site probably null
R2141:Optc UTSW 1 133903796 splice site probably null
R2142:Optc UTSW 1 133903796 splice site probably null
R3436:Optc UTSW 1 133897879 missense probably damaging 1.00
R3437:Optc UTSW 1 133897879 missense probably damaging 1.00
R3711:Optc UTSW 1 133905081 missense probably benign 0.15
R3902:Optc UTSW 1 133897963 missense probably benign 0.10
R3930:Optc UTSW 1 133901182 nonsense probably null
R4078:Optc UTSW 1 133898349 missense probably damaging 1.00
R4672:Optc UTSW 1 133897817 missense possibly damaging 0.48
R5113:Optc UTSW 1 133900977 splice site probably benign
R5176:Optc UTSW 1 133902084 missense probably benign 0.00
R5530:Optc UTSW 1 133905090 missense probably benign 0.01
R5692:Optc UTSW 1 133900976 splice site probably benign
R5819:Optc UTSW 1 133897879 missense probably damaging 1.00
R6208:Optc UTSW 1 133904999 missense probably damaging 1.00
R6828:Optc UTSW 1 133897867 missense probably damaging 1.00
R6859:Optc UTSW 1 133897816 missense possibly damaging 0.95
R6986:Optc UTSW 1 133897964 missense probably benign 0.00
R7349:Optc UTSW 1 133897879 missense probably damaging 1.00
R7754:Optc UTSW 1 133906992 missense possibly damaging 0.73
R8270:Optc UTSW 1 133905072 missense probably benign 0.02
X0025:Optc UTSW 1 133897911 missense probably damaging 1.00
Z1177:Optc UTSW 1 133901085 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TGTAGAACTGCCTGGTGCTAG -3'
(R):5'- TGTATGGAGTCGCTCAATGC -3'

Sequencing Primer
(F):5'- AGAACTGCCTGGTGCTAGCTTAAG -3'
(R):5'- AATGCTCTGCTCGATAAGGC -3'
Posted On2015-08-18