Incidental Mutation 'R4523:Sh3glb2'
ID334288
Institutional Source Beutler Lab
Gene Symbol Sh3glb2
Ensembl Gene ENSMUSG00000026860
Gene NameSH3-domain GRB2-like endophilin B2
SynonymsSPAS-1; mKIAA1848
MMRRC Submission 042004-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R4523 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location30344809-30359337 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30350699 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 118 (V118E)
Ref Sequence ENSEMBL: ENSMUSP00000109251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028214] [ENSMUST00000100215] [ENSMUST00000113620] [ENSMUST00000113621] [ENSMUST00000163668]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028214
AA Change: V118E

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028214
Gene: ENSMUSG00000026860
AA Change: V118E

DomainStartEndE-ValueType
BAR 7 280 8.25e-92 SMART
low complexity region 288 334 N/A INTRINSIC
SH3 338 395 2.16e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100215
AA Change: V118E

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097788
Gene: ENSMUSG00000026860
AA Change: V118E

DomainStartEndE-ValueType
BAR 7 280 4.42e-92 SMART
low complexity region 293 339 N/A INTRINSIC
SH3 343 400 2.16e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113620
AA Change: V118E

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109250
Gene: ENSMUSG00000026860
AA Change: V118E

DomainStartEndE-ValueType
BAR 7 259 3.85e-92 SMART
low complexity region 267 313 N/A INTRINSIC
SH3 317 374 2.16e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113621
AA Change: V118E

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109251
Gene: ENSMUSG00000026860
AA Change: V118E

DomainStartEndE-ValueType
BAR 7 284 5.36e-91 SMART
low complexity region 297 343 N/A INTRINSIC
SH3 347 404 2.16e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140899
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146400
Predicted Effect possibly damaging
Transcript: ENSMUST00000163668
AA Change: V118E

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131545
Gene: ENSMUSG00000026860
AA Change: V118E

DomainStartEndE-ValueType
BAR 7 259 2.06e-92 SMART
low complexity region 272 318 N/A INTRINSIC
SH3 322 379 2.16e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151145
Meta Mutation Damage Score 0.8960 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8a1 G T 5: 67,667,600 T796K probably benign Het
Atr T C 9: 95,862,863 S78P probably damaging Het
BC017643 A G 11: 121,224,108 probably benign Het
Calb2 C T 8: 110,148,509 probably null Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cdca7 A G 2: 72,479,698 S77G probably damaging Het
Cnot2 C T 10: 116,581,474 probably benign Het
Cstf2t T A 19: 31,083,082 V6D possibly damaging Het
Dido1 T C 2: 180,672,292 I852V probably damaging Het
Dmgdh C T 13: 93,688,630 Q154* probably null Het
Dnah12 T C 14: 26,770,022 F1138S probably damaging Het
Dnah12 G A 14: 26,876,958 A998T possibly damaging Het
Dusp5 T G 19: 53,537,601 Y225D probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam126a T C 5: 23,965,122 T410A probably benign Het
Fam193a G A 5: 34,443,371 D601N probably benign Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Fmo2 T C 1: 162,887,708 K115R probably benign Het
Gak G T 5: 108,576,566 Q1093K probably benign Het
Gm5277 G T 3: 78,892,186 noncoding transcript Het
Gm7173 A T X: 79,509,995 N291K possibly damaging Het
Hgsnat A G 8: 25,968,361 probably null Het
Map3k3 G A 11: 106,148,868 R278H probably damaging Het
Mrvi1 T C 7: 110,923,841 M338V probably benign Het
Muc4 T C 16: 32,736,336 probably benign Het
Nectin3 C A 16: 46,448,590 R483L probably benign Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Ntng1 A G 3: 109,934,996 S154P probably damaging Het
Olfml2b T C 1: 170,669,222 I474T probably benign Het
Olfr1054 C G 2: 86,333,300 D19H probably benign Het
Olfr843 T C 9: 19,249,229 T57A probably damaging Het
Optc G T 1: 133,903,754 T138K possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pard3 C T 8: 127,398,627 P421S probably benign Het
Pcdhb22 G T 18: 37,520,421 E647D probably benign Het
Pclo A G 5: 14,679,992 probably benign Het
Prkce G T 17: 86,490,750 probably null Het
Prr12 T C 7: 45,048,523 D656G unknown Het
Ptprk A T 10: 28,466,052 D485V probably damaging Het
Ptprn2 T C 12: 116,876,000 L381P probably damaging Het
Rnf144b T C 13: 47,207,537 I51T probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Sipa1l2 C T 8: 125,492,424 G58D probably damaging Het
Slc5a4a C T 10: 76,148,362 A46V probably damaging Het
Tepp T A 8: 95,313,010 Y18* probably null Het
Tgm7 C A 2: 121,098,588 probably null Het
Tjap1 A G 17: 46,258,792 V424A probably benign Het
Trpm6 A T 19: 18,796,500 I414F probably damaging Het
Tsr3 C G 17: 25,241,749 D196E probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Vmn2r97 T A 17: 18,929,071 N240K probably benign Het
Xdh C A 17: 73,898,344 G1042V probably damaging Het
Zcchc4 A G 5: 52,784,067 D68G probably damaging Het
Other mutations in Sh3glb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01638:Sh3glb2 APN 2 30345850 missense possibly damaging 0.73
IGL02189:Sh3glb2 APN 2 30345339 unclassified probably null
IGL02724:Sh3glb2 APN 2 30346356 missense probably benign 0.02
IGL03352:Sh3glb2 APN 2 30345351 missense probably damaging 1.00
little UTSW 2 30354975 missense probably damaging 1.00
R1162:Sh3glb2 UTSW 2 30350588 missense probably damaging 1.00
R1517:Sh3glb2 UTSW 2 30354975 missense probably damaging 1.00
R1725:Sh3glb2 UTSW 2 30350667 nonsense probably null
R3894:Sh3glb2 UTSW 2 30355288 missense probably damaging 0.97
R5587:Sh3glb2 UTSW 2 30354851 critical splice donor site probably null
R5933:Sh3glb2 UTSW 2 30350389 splice site probably null
R6215:Sh3glb2 UTSW 2 30345793 missense possibly damaging 0.88
R6679:Sh3glb2 UTSW 2 30350619 missense probably damaging 1.00
R6998:Sh3glb2 UTSW 2 30355321 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCCTGGGATGAAAACCTATGTG -3'
(R):5'- GTGTGTTCTTGAGACACCAGG -3'

Sequencing Primer
(F):5'- TGAAAACCTATGTGTAGAGTTCGG -3'
(R):5'- TCATGCCCTGCCTACAAGG -3'
Posted On2015-08-18