Mutagenetix > Incidental Mutation

Incidental Mutation 'R4523:Dido1'

334293

Institutional Source

Beutler Lab

Gene Symbol

Dido1

Ensembl Gene

ENSMUSG00000038914

Gene Name

death inducer-obliterator 1

Synonyms

6720461J16Rik, DIO-1, Datf1, D130048F08Rik

MMRRC Submission

042004-MU

Accession Numbers

Genbank: NM_175551; MGI: 1344352

Is this an essential gene?

Probably essential (E-score: 0.959) question?

Stock #

R4523 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

180657964-180709999 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 180672292 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 852 (I852V)

Ref Sequence

ENSEMBL: ENSMUSP00000099346 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037764] [ENSMUST00000087517] [ENSMUST00000103056] [ENSMUST00000103057]

AlphaFold

Q8C9B9

Predicted Effect

probably damaging
Transcript: ENSMUST00000037764
AA Change: I312V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000048315
Gene: ENSMUSG00000038914
AA Change: I312V

Domain	Start	End	E-Value	Type
TFS2M	129	230	1.16e-45	SMART
low complexity region	397	422	N/A	INTRINSIC
low complexity region	483	497	N/A	INTRINSIC
Pfam:SPOC	512	618	4.9e-23	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000087517
AA Change: I852V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000084794
Gene: ENSMUSG00000038914
AA Change: I852V

Domain	Start	End	E-Value	Type
low complexity region	134	155	N/A	INTRINSIC
PHD	267	317	1.19e-11	SMART
low complexity region	430	446	N/A	INTRINSIC
TFS2M	669	770	1.16e-45	SMART
low complexity region	937	962	N/A	INTRINSIC
low complexity region	1023	1037	N/A	INTRINSIC
Pfam:SPOC	1052	1158	1e-22	PFAM
low complexity region	1253	1267	N/A	INTRINSIC
low complexity region	1279	1308	N/A	INTRINSIC
low complexity region	1372	1391	N/A	INTRINSIC
coiled coil region	1458	1502	N/A	INTRINSIC
low complexity region	1649	1680	N/A	INTRINSIC
low complexity region	1748	1766	N/A	INTRINSIC
low complexity region	1780	1792	N/A	INTRINSIC
low complexity region	1804	1815	N/A	INTRINSIC
internal_repeat_2	1816	1852	3.9e-5	PROSPERO
internal_repeat_1	1819	1859	6.92e-7	PROSPERO
internal_repeat_2	1926	1964	3.9e-5	PROSPERO
internal_repeat_1	1940	1982	6.92e-7	PROSPERO
low complexity region	2025	2045	N/A	INTRINSIC
low complexity region	2123	2160	N/A	INTRINSIC
low complexity region	2163	2177	N/A	INTRINSIC
low complexity region	2182	2239	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000103056
AA Change: I852V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000099345
Gene: ENSMUSG00000038914
AA Change: I852V

Domain	Start	End	E-Value	Type
low complexity region	134	155	N/A	INTRINSIC
PHD	267	317	1.19e-11	SMART
low complexity region	430	446	N/A	INTRINSIC
TFS2M	669	770	1.16e-45	SMART
low complexity region	937	962	N/A	INTRINSIC
low complexity region	1023	1037	N/A	INTRINSIC
Pfam:SPOC	1052	1158	4.7e-23	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000103057
AA Change: I852V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000099346
Gene: ENSMUSG00000038914
AA Change: I852V

Domain	Start	End	E-Value	Type
low complexity region	134	155	N/A	INTRINSIC
PHD	267	317	1.19e-11	SMART
low complexity region	430	446	N/A	INTRINSIC
TFS2M	669	770	1.16e-45	SMART
low complexity region	937	962	N/A	INTRINSIC
low complexity region	1023	1037	N/A	INTRINSIC
Pfam:SPOC	1052	1158	4.7e-23	PFAM

Meta Mutation Damage Score

0.1694

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: This gene encodes a transcription factor involved in apoptosis. The encoded protein functions in cell cycle progression and plays a role in chromosomal stability. This protein regulates the self-renewal of embryonic stem cells. Disruption of this gene in mice causes symptoms similar to myelodysplastic/myeloproliferative diseases in humans. Mice lacking this gene show severely reduced fertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severely reduced fertility; about one-half develop a transplantable disease characterized by anomalies in spleen, bone marrow, and peripheral blood and including anemia and various symptoms typical of myeloid dysplasia or myeloid proliferation. [provided by MGI curators]

Allele List at MGI

All alleles(245) : Targeted, knock-out(1) Gene trapped(244)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp8a1	G	T	5: 67,667,600	T796K	probably benign	Het
Atr	T	C	9: 95,862,863	S78P	probably damaging	Het
BC017643	A	G	11: 121,224,108		probably benign	Het
Calb2	C	T	8: 110,148,509		probably null	Het
Ccdc88c	G	T	12: 100,913,332	S1843R	possibly damaging	Het
Cdca7	A	G	2: 72,479,698	S77G	probably damaging	Het
Cnot2	C	T	10: 116,581,474		probably benign	Het
Cstf2t	T	A	19: 31,083,082	V6D	possibly damaging	Het
Dmgdh	C	T	13: 93,688,630	Q154*	probably null	Het
Dnah12	T	C	14: 26,770,022	F1138S	probably damaging	Het
Dnah12	G	A	14: 26,876,958	A998T	possibly damaging	Het
Dusp5	T	G	19: 53,537,601	Y225D	probably damaging	Het
Fam122c	G	A	X: 53,293,499	R94H	possibly damaging	Het
Fam126a	T	C	5: 23,965,122	T410A	probably benign	Het
Fam193a	G	A	5: 34,443,371	D601N	probably benign	Het
Fbxo41	A	G	6: 85,484,042	I228T	probably damaging	Het
Fmo2	T	C	1: 162,887,708	K115R	probably benign	Het
Gak	G	T	5: 108,576,566	Q1093K	probably benign	Het
Gm5277	G	T	3: 78,892,186		noncoding transcript	Het
Gm7173	A	T	X: 79,509,995	N291K	possibly damaging	Het
Hgsnat	A	G	8: 25,968,361		probably null	Het
Map3k3	G	A	11: 106,148,868	R278H	probably damaging	Het
Mrvi1	T	C	7: 110,923,841	M338V	probably benign	Het
Muc4	T	C	16: 32,736,336		probably benign	Het
Nectin3	C	A	16: 46,448,590	R483L	probably benign	Het
Nop2	G	T	6: 125,133,552	R47L	probably damaging	Het
Ntng1	A	G	3: 109,934,996	S154P	probably damaging	Het
Olfml2b	T	C	1: 170,669,222	I474T	probably benign	Het
Olfr1054	C	G	2: 86,333,300	D19H	probably benign	Het
Olfr843	T	C	9: 19,249,229	T57A	probably damaging	Het
Optc	G	T	1: 133,903,754	T138K	possibly damaging	Het
Orc4	G	A	2: 48,937,489	P31S	probably benign	Het
Pard3	C	T	8: 127,398,627	P421S	probably benign	Het
Pcdhb22	G	T	18: 37,520,421	E647D	probably benign	Het
Pclo	A	G	5: 14,679,992		probably benign	Het
Prkce	G	T	17: 86,490,750		probably null	Het
Prr12	T	C	7: 45,048,523	D656G	unknown	Het
Ptprk	A	T	10: 28,466,052	D485V	probably damaging	Het
Ptprn2	T	C	12: 116,876,000	L381P	probably damaging	Het
Rnf144b	T	C	13: 47,207,537	I51T	probably benign	Het
Rpl10l	T	C	12: 66,283,738	D207G	probably benign	Het
Sh3glb2	A	T	2: 30,350,699	V118E	probably damaging	Het
Sipa1l2	C	T	8: 125,492,424	G58D	probably damaging	Het
Slc5a4a	C	T	10: 76,148,362	A46V	probably damaging	Het
Tepp	T	A	8: 95,313,010	Y18*	probably null	Het
Tgm7	C	A	2: 121,098,588		probably null	Het
Tjap1	A	G	17: 46,258,792	V424A	probably benign	Het
Trpm6	A	T	19: 18,796,500	I414F	probably damaging	Het
Tsr3	C	G	17: 25,241,749	D196E	probably benign	Het
Ubqlnl	C	T	7: 104,149,718	V191M	probably benign	Het
Vmn2r72	T	A	7: 85,751,926	H95L	probably benign	Het
Vmn2r97	T	A	17: 18,929,071	N240K	probably benign	Het
Xdh	C	A	17: 73,898,344	G1042V	probably damaging	Het
Zcchc4	A	G	5: 52,784,067	D68G	probably damaging	Het

Other mutations in Dido1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Dido1	APN	2	180683989	missense	probably benign
IGL00834:Dido1	APN	2	180689526	missense	possibly damaging	0.87
IGL01317:Dido1	APN	2	180671757	missense	probably benign	0.17
IGL01588:Dido1	APN	2	180688875	missense	probably benign	0.00
IGL01834:Dido1	APN	2	180684031	splice site	probably benign
IGL02102:Dido1	APN	2	180662247	missense	possibly damaging	0.58
IGL02556:Dido1	APN	2	180689335	missense	possibly damaging	0.69
IGL02756:Dido1	APN	2	180661923	missense	probably benign	0.00
IGL02826:Dido1	APN	2	180683958	missense	probably benign
IGL02970:Dido1	APN	2	180689415	missense	probably damaging	0.99
IGL03110:Dido1	APN	2	180689342	missense	probably damaging	1.00
IGL03116:Dido1	APN	2	180670979	missense	probably damaging	1.00
3370:Dido1	UTSW	2	180671542	missense	probably benign
A4554:Dido1	UTSW	2	180675371	missense	probably damaging	1.00
H8441:Dido1	UTSW	2	180689014	missense	probably benign	0.12
R0044:Dido1	UTSW	2	180661819	missense	probably damaging	1.00
R0044:Dido1	UTSW	2	180661819	missense	probably damaging	1.00
R0054:Dido1	UTSW	2	180661474	missense	probably benign	0.00
R0054:Dido1	UTSW	2	180661474	missense	probably benign	0.00
R0127:Dido1	UTSW	2	180671824	missense	probably benign	0.01
R0620:Dido1	UTSW	2	180659851	missense	probably benign	0.26
R0734:Dido1	UTSW	2	180660042	missense	probably benign	0.01
R1390:Dido1	UTSW	2	180685124	missense	possibly damaging	0.70
R1445:Dido1	UTSW	2	180671470	missense	possibly damaging	0.62
R1466:Dido1	UTSW	2	180662328	missense	probably damaging	1.00
R1466:Dido1	UTSW	2	180662328	missense	probably damaging	1.00
R1472:Dido1	UTSW	2	180660720	missense	probably benign	0.02
R1538:Dido1	UTSW	2	180684970	missense	possibly damaging	0.49
R1584:Dido1	UTSW	2	180662328	missense	probably damaging	1.00
R2020:Dido1	UTSW	2	180659585	missense	unknown
R2025:Dido1	UTSW	2	180689181	nonsense	probably null
R2026:Dido1	UTSW	2	180689181	nonsense	probably null
R2027:Dido1	UTSW	2	180689181	nonsense	probably null
R2089:Dido1	UTSW	2	180661884	missense	probably benign	0.29
R2091:Dido1	UTSW	2	180661884	missense	probably benign	0.29
R2091:Dido1	UTSW	2	180661884	missense	probably benign	0.29
R2495:Dido1	UTSW	2	180689388	missense	probably benign	0.00
R2931:Dido1	UTSW	2	180661653	missense	probably damaging	1.00
R3418:Dido1	UTSW	2	180660935	missense	possibly damaging	0.84
R3735:Dido1	UTSW	2	180684036	splice site	probably benign
R4674:Dido1	UTSW	2	180687559	missense	probably damaging	0.97
R4729:Dido1	UTSW	2	180687650	missense	probably benign	0.00
R4762:Dido1	UTSW	2	180689575	missense	probably damaging	1.00
R4786:Dido1	UTSW	2	180670871	missense	possibly damaging	0.85
R4817:Dido1	UTSW	2	180661416	missense	probably benign	0.02
R4892:Dido1	UTSW	2	180675029	nonsense	probably null
R4979:Dido1	UTSW	2	180660813	missense	probably damaging	0.98
R5510:Dido1	UTSW	2	180685173	missense	probably benign	0.00
R5586:Dido1	UTSW	2	180659652	nonsense	probably null
R5672:Dido1	UTSW	2	180671903	missense	probably damaging	0.99
R5863:Dido1	UTSW	2	180661773	missense	probably benign	0.02
R5943:Dido1	UTSW	2	180661882	missense	probably benign	0.00
R5974:Dido1	UTSW	2	180671497	missense	probably benign	0.02
R6123:Dido1	UTSW	2	180683967	missense	probably benign	0.07
R6214:Dido1	UTSW	2	180662152	missense	probably damaging	1.00
R6215:Dido1	UTSW	2	180662152	missense	probably damaging	1.00
R6248:Dido1	UTSW	2	180660255	missense	probably damaging	1.00
R6285:Dido1	UTSW	2	180661147	missense	probably benign	0.00
R6349:Dido1	UTSW	2	180660701	missense	probably benign	0.03
R6437:Dido1	UTSW	2	180675013	missense	probably damaging	1.00
R6477:Dido1	UTSW	2	180660481	missense	probably benign	0.00
R6836:Dido1	UTSW	2	180662307	missense	probably benign	0.16
R7055:Dido1	UTSW	2	180661209	missense	probably benign	0.09
R7289:Dido1	UTSW	2	180659631	missense	unknown
R7304:Dido1	UTSW	2	180687493	missense	probably damaging	1.00
R7343:Dido1	UTSW	2	180675121	missense	possibly damaging	0.49
R7363:Dido1	UTSW	2	180662517	nonsense	probably null
R7429:Dido1	UTSW	2	180689526	missense	possibly damaging	0.87
R7594:Dido1	UTSW	2	180675112	missense	probably benign
R7629:Dido1	UTSW	2	180661473	missense	probably benign
R7899:Dido1	UTSW	2	180671597	missense	possibly damaging	0.82
R7946:Dido1	UTSW	2	180661708	missense	possibly damaging	0.81
R7951:Dido1	UTSW	2	180670881	missense	probably benign	0.01
R8033:Dido1	UTSW	2	180674842	missense	probably damaging	1.00
R8069:Dido1	UTSW	2	180660912	missense	probably benign
R8331:Dido1	UTSW	2	180660449	missense	probably benign	0.00
R8479:Dido1	UTSW	2	180673229	critical splice donor site	probably null
R8936:Dido1	UTSW	2	180661402	missense	probably benign
R9089:Dido1	UTSW	2	180661500	missense	probably benign	0.00
R9647:Dido1	UTSW	2	180673275	missense	probably benign	0.00
R9648:Dido1	UTSW	2	180660675	missense	probably damaging	1.00
R9784:Dido1	UTSW	2	180683561	missense	probably benign	0.27
V1024:Dido1	UTSW	2	180689014	missense	probably benign	0.12
X0011:Dido1	UTSW	2	180660834	missense	probably benign	0.00
X0019:Dido1	UTSW	2	180671572	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- GCTAGTGAGAAGAGCAATTTTCCC -3'
(R):5'- TGCTGCATTGAGAGACAGTC -3'

Sequencing Primer
(F):5'- CCTGGAATTTACTCTGTGGACCAG -3'
(R):5'- GTCTCAAGAAAACAACAAAGGCAAG -3'

Posted On

2015-08-18