Incidental Mutation 'R4523:Ntng1'
ID 334295
Institutional Source Beutler Lab
Gene Symbol Ntng1
Ensembl Gene ENSMUSG00000059857
Gene Name netrin G1
Synonyms Lmnt1, A930010C08Rik
MMRRC Submission 042004-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4523 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 109687356-110051327 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 109842312 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 154 (S154P)
Ref Sequence ENSEMBL: ENSMUSP00000119534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072596] [ENSMUST00000106570] [ENSMUST00000106571] [ENSMUST00000106575] [ENSMUST00000128219] [ENSMUST00000131027] [ENSMUST00000138953] [ENSMUST00000133268] [ENSMUST00000138344] [ENSMUST00000156177]
AlphaFold Q8R4G0
Predicted Effect probably damaging
Transcript: ENSMUST00000072596
AA Change: S154P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072397
Gene: ENSMUSG00000059857
AA Change: S154P

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF_Lam 364 417 4.81e-8 SMART
EGF_Lam 420 462 5.74e-6 SMART
EGF 466 498 5.12e-3 SMART
low complexity region 522 537 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106570
AA Change: S154P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102180
Gene: ENSMUSG00000059857
AA Change: S154P

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 355 1.28e-3 SMART
EGF 388 420 5.12e-3 SMART
low complexity region 444 459 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106571
AA Change: S154P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102181
Gene: ENSMUSG00000059857
AA Change: S154P

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF 408 440 5.12e-3 SMART
low complexity region 464 479 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106575
AA Change: S154P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102185
Gene: ENSMUSG00000059857
AA Change: S154P

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 355 3.33e-2 SMART
EGF_Lam 364 417 4.81e-8 SMART
EGF_Lam 420 462 5.74e-6 SMART
EGF 466 498 5.12e-3 SMART
low complexity region 522 537 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000128219
AA Change: S154P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116579
Gene: ENSMUSG00000059857
AA Change: S154P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LamNT 59 295 1.5e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131027
AA Change: S154P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118800
Gene: ENSMUSG00000059857
AA Change: S154P

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF_Lam 364 417 4.81e-8 SMART
EGF 421 453 5.12e-3 SMART
low complexity region 477 492 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138953
AA Change: S154P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116213
Gene: ENSMUSG00000059857
AA Change: S154P

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF 407 439 5.12e-3 SMART
low complexity region 463 478 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000133268
AA Change: S154P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117371
Gene: ENSMUSG00000059857
AA Change: S154P

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF 365 397 5.12e-3 SMART
low complexity region 421 436 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138344
AA Change: S154P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120688
Gene: ENSMUSG00000059857
AA Change: S154P

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF_Lam 364 406 5.74e-6 SMART
EGF 410 442 5.12e-3 SMART
low complexity region 466 481 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000156177
AA Change: S154P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119534
Gene: ENSMUSG00000059857
AA Change: S154P

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF 387 419 5.12e-3 SMART
low complexity region 443 458 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189335
Meta Mutation Damage Score 0.8259 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a preproprotein that is processed into a secreted protein containing eukaroytic growth factor (EGF)-like domains. This protein acts to guide axon growth during neuronal development. Polymorphisms in this gene may be associated with schizophrenia. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele survive into adulthood with no major alterations in gross brain cytoarchitecture or axonal projection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8a1 G T 5: 67,824,943 (GRCm39) T796K probably benign Het
Atr T C 9: 95,744,916 (GRCm39) S78P probably damaging Het
Calb2 C T 8: 110,875,141 (GRCm39) probably null Het
Ccdc88c G T 12: 100,879,591 (GRCm39) S1843R possibly damaging Het
Cdca7 A G 2: 72,310,042 (GRCm39) S77G probably damaging Het
Cfap47 A T X: 78,553,601 (GRCm39) N291K possibly damaging Het
Cnot2 C T 10: 116,417,379 (GRCm39) probably benign Het
Cstf2t T A 19: 31,060,482 (GRCm39) V6D possibly damaging Het
Cybc1 A G 11: 121,114,934 (GRCm39) probably benign Het
Dido1 T C 2: 180,314,085 (GRCm39) I852V probably damaging Het
Dmgdh C T 13: 93,825,138 (GRCm39) Q154* probably null Het
Dnah12 T C 14: 26,491,979 (GRCm39) F1138S probably damaging Het
Dnah12 G A 14: 26,598,915 (GRCm39) A998T possibly damaging Het
Dusp5 T G 19: 53,526,032 (GRCm39) Y225D probably damaging Het
Fam193a G A 5: 34,600,715 (GRCm39) D601N probably benign Het
Fbxo41 A G 6: 85,461,024 (GRCm39) I228T probably damaging Het
Fmo2 T C 1: 162,715,277 (GRCm39) K115R probably benign Het
Gak G T 5: 108,724,432 (GRCm39) Q1093K probably benign Het
Gm5277 G T 3: 78,799,493 (GRCm39) noncoding transcript Het
Hgsnat A G 8: 26,458,389 (GRCm39) probably null Het
Hycc1 T C 5: 24,170,120 (GRCm39) T410A probably benign Het
Irag1 T C 7: 110,523,048 (GRCm39) M338V probably benign Het
Map3k3 G A 11: 106,039,694 (GRCm39) R278H probably damaging Het
Muc4 T C 16: 32,555,154 (GRCm39) probably benign Het
Nectin3 C A 16: 46,268,953 (GRCm39) R483L probably benign Het
Nop2 G T 6: 125,110,515 (GRCm39) R47L probably damaging Het
Olfml2b T C 1: 170,496,791 (GRCm39) I474T probably benign Het
Optc G T 1: 133,831,492 (GRCm39) T138K possibly damaging Het
Or7g25 T C 9: 19,160,525 (GRCm39) T57A probably damaging Het
Or8k22 C G 2: 86,163,644 (GRCm39) D19H probably benign Het
Orc4 G A 2: 48,827,501 (GRCm39) P31S probably benign Het
Pabir3 G A X: 52,382,376 (GRCm39) R94H possibly damaging Het
Pard3 C T 8: 128,125,108 (GRCm39) P421S probably benign Het
Pcdhb22 G T 18: 37,653,474 (GRCm39) E647D probably benign Het
Pclo A G 5: 14,730,006 (GRCm39) probably benign Het
Prkce G T 17: 86,798,178 (GRCm39) probably null Het
Prr12 T C 7: 44,697,947 (GRCm39) D656G unknown Het
Ptprk A T 10: 28,342,048 (GRCm39) D485V probably damaging Het
Ptprn2 T C 12: 116,839,620 (GRCm39) L381P probably damaging Het
Rnf144b T C 13: 47,361,013 (GRCm39) I51T probably benign Het
Rpl10l T C 12: 66,330,512 (GRCm39) D207G probably benign Het
Sh3glb2 A T 2: 30,240,711 (GRCm39) V118E probably damaging Het
Sipa1l2 C T 8: 126,219,163 (GRCm39) G58D probably damaging Het
Slc5a4a C T 10: 75,984,196 (GRCm39) A46V probably damaging Het
Spmip8 T A 8: 96,039,638 (GRCm39) Y18* probably null Het
Tgm7 C A 2: 120,929,069 (GRCm39) probably null Het
Tjap1 A G 17: 46,569,718 (GRCm39) V424A probably benign Het
Trpm6 A T 19: 18,773,864 (GRCm39) I414F probably damaging Het
Tsr3 C G 17: 25,460,723 (GRCm39) D196E probably benign Het
Ubqlnl C T 7: 103,798,925 (GRCm39) V191M probably benign Het
Vmn2r72 T A 7: 85,401,134 (GRCm39) H95L probably benign Het
Vmn2r97 T A 17: 19,149,333 (GRCm39) N240K probably benign Het
Xdh C A 17: 74,205,339 (GRCm39) G1042V probably damaging Het
Zcchc4 A G 5: 52,941,409 (GRCm39) D68G probably damaging Het
Other mutations in Ntng1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02162:Ntng1 APN 3 109,842,311 (GRCm39) nonsense probably null
IGL02367:Ntng1 APN 3 110,042,829 (GRCm39) splice site probably null
IGL02448:Ntng1 APN 3 109,841,875 (GRCm39) splice site probably benign
IGL02487:Ntng1 APN 3 109,842,363 (GRCm39) missense probably damaging 0.98
IGL02500:Ntng1 APN 3 110,042,646 (GRCm39) missense probably damaging 1.00
IGL02578:Ntng1 APN 3 110,042,710 (GRCm39) missense probably benign 0.01
IGL03009:Ntng1 APN 3 109,842,018 (GRCm39) missense possibly damaging 0.89
IGL03096:Ntng1 APN 3 110,042,665 (GRCm39) missense probably benign 0.19
R0108:Ntng1 UTSW 3 109,759,071 (GRCm39) splice site probably benign
R0326:Ntng1 UTSW 3 110,042,819 (GRCm39) nonsense probably null
R0403:Ntng1 UTSW 3 109,841,927 (GRCm39) missense probably damaging 0.97
R0699:Ntng1 UTSW 3 109,779,611 (GRCm39) missense probably damaging 1.00
R0702:Ntng1 UTSW 3 109,779,570 (GRCm39) missense probably damaging 1.00
R1981:Ntng1 UTSW 3 109,842,326 (GRCm39) missense possibly damaging 0.61
R2096:Ntng1 UTSW 3 109,739,871 (GRCm39) missense probably damaging 0.99
R3739:Ntng1 UTSW 3 109,842,007 (GRCm39) missense probably damaging 1.00
R3963:Ntng1 UTSW 3 109,842,184 (GRCm39) missense probably damaging 1.00
R4484:Ntng1 UTSW 3 110,051,124 (GRCm39) unclassified probably benign
R4516:Ntng1 UTSW 3 109,842,329 (GRCm39) missense probably damaging 1.00
R4518:Ntng1 UTSW 3 109,842,329 (GRCm39) missense probably damaging 1.00
R4520:Ntng1 UTSW 3 109,842,312 (GRCm39) missense probably damaging 1.00
R4524:Ntng1 UTSW 3 109,842,312 (GRCm39) missense probably damaging 1.00
R4776:Ntng1 UTSW 3 109,842,029 (GRCm39) missense probably damaging 1.00
R4817:Ntng1 UTSW 3 109,842,184 (GRCm39) missense probably damaging 1.00
R4827:Ntng1 UTSW 3 110,042,727 (GRCm39) missense probably damaging 1.00
R4990:Ntng1 UTSW 3 110,042,577 (GRCm39) critical splice donor site probably null
R5067:Ntng1 UTSW 3 110,042,661 (GRCm39) missense possibly damaging 0.95
R5087:Ntng1 UTSW 3 110,042,645 (GRCm39) nonsense probably null
R5196:Ntng1 UTSW 3 109,842,299 (GRCm39) missense probably damaging 1.00
R5263:Ntng1 UTSW 3 109,842,188 (GRCm39) missense probably damaging 0.99
R5743:Ntng1 UTSW 3 110,042,736 (GRCm39) missense probably damaging 1.00
R6268:Ntng1 UTSW 3 109,842,351 (GRCm39) missense probably damaging 1.00
R6292:Ntng1 UTSW 3 110,051,202 (GRCm39) unclassified probably benign
R6419:Ntng1 UTSW 3 109,690,169 (GRCm39) missense possibly damaging 0.95
R6898:Ntng1 UTSW 3 109,779,534 (GRCm39) missense probably damaging 0.98
R7081:Ntng1 UTSW 3 109,759,105 (GRCm39) missense probably benign 0.00
R7090:Ntng1 UTSW 3 109,842,496 (GRCm39) nonsense probably null
R7134:Ntng1 UTSW 3 109,842,445 (GRCm39) missense probably benign
R7302:Ntng1 UTSW 3 109,739,933 (GRCm39) missense possibly damaging 0.94
R7353:Ntng1 UTSW 3 110,042,763 (GRCm39) missense probably damaging 1.00
R7408:Ntng1 UTSW 3 109,760,398 (GRCm39) missense probably benign 0.00
R7610:Ntng1 UTSW 3 109,842,141 (GRCm39) missense probably damaging 1.00
R7686:Ntng1 UTSW 3 109,842,330 (GRCm39) missense possibly damaging 0.80
R7972:Ntng1 UTSW 3 110,042,802 (GRCm39) missense probably benign 0.02
R9210:Ntng1 UTSW 3 109,779,633 (GRCm39) missense probably damaging 1.00
R9214:Ntng1 UTSW 3 109,841,921 (GRCm39) missense probably damaging 1.00
R9266:Ntng1 UTSW 3 110,051,162 (GRCm39) missense unknown
R9266:Ntng1 UTSW 3 110,050,923 (GRCm39) unclassified probably benign
R9364:Ntng1 UTSW 3 110,042,680 (GRCm39) missense probably damaging 0.97
R9593:Ntng1 UTSW 3 109,842,224 (GRCm39) missense probably damaging 1.00
R9596:Ntng1 UTSW 3 110,042,956 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGTGGAGTACTCTTCCGTGC -3'
(R):5'- TCTTTGTCTTCCATAGGGCAAC -3'

Sequencing Primer
(F):5'- GAGTACTCTTCCGTGCAAATG -3'
(R):5'- TAATGAGTGTGATGCGAGTACCCC -3'
Posted On 2015-08-18