Incidental Mutation 'R4523:Zcchc4'
ID334299
Institutional Source Beutler Lab
Gene Symbol Zcchc4
Ensembl Gene ENSMUSG00000029179
Gene Namezinc finger, CCHC domain containing 4
Synonyms4930449I23Rik
MMRRC Submission 042004-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R4523 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location52775409-52824665 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52784067 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 68 (D68G)
Ref Sequence ENSEMBL: ENSMUSP00000109537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031077] [ENSMUST00000113904]
Predicted Effect probably damaging
Transcript: ENSMUST00000031077
AA Change: D68G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031077
Gene: ENSMUSG00000029179
AA Change: D68G

DomainStartEndE-ValueType
Pfam:zf-GRF 37 81 2.9e-19 PFAM
Pfam:N6-adenineMlase 168 337 5.1e-11 PFAM
ZnF_C2HC 442 458 1.27e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113901
SMART Domains Protein: ENSMUSP00000109534
Gene: ENSMUSG00000029179

DomainStartEndE-ValueType
ZnF_C2HC 226 242 1.27e-2 SMART
low complexity region 248 266 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113904
AA Change: D68G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109537
Gene: ENSMUSG00000029179
AA Change: D68G

DomainStartEndE-ValueType
Pfam:zf-GRF 37 81 2.4e-17 PFAM
Pfam:N6-adenineMlase 168 338 7.1e-11 PFAM
ZnF_C2HC 442 458 1.27e-2 SMART
low complexity region 464 482 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157074
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198465
Predicted Effect unknown
Transcript: ENSMUST00000199840
AA Change: D59G
Meta Mutation Damage Score 0.7933 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8a1 G T 5: 67,667,600 T796K probably benign Het
Atr T C 9: 95,862,863 S78P probably damaging Het
BC017643 A G 11: 121,224,108 probably benign Het
Calb2 C T 8: 110,148,509 probably null Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cdca7 A G 2: 72,479,698 S77G probably damaging Het
Cnot2 C T 10: 116,581,474 probably benign Het
Cstf2t T A 19: 31,083,082 V6D possibly damaging Het
Dido1 T C 2: 180,672,292 I852V probably damaging Het
Dmgdh C T 13: 93,688,630 Q154* probably null Het
Dnah12 T C 14: 26,770,022 F1138S probably damaging Het
Dnah12 G A 14: 26,876,958 A998T possibly damaging Het
Dusp5 T G 19: 53,537,601 Y225D probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam126a T C 5: 23,965,122 T410A probably benign Het
Fam193a G A 5: 34,443,371 D601N probably benign Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Fmo2 T C 1: 162,887,708 K115R probably benign Het
Gak G T 5: 108,576,566 Q1093K probably benign Het
Gm5277 G T 3: 78,892,186 noncoding transcript Het
Gm7173 A T X: 79,509,995 N291K possibly damaging Het
Hgsnat A G 8: 25,968,361 probably null Het
Map3k3 G A 11: 106,148,868 R278H probably damaging Het
Mrvi1 T C 7: 110,923,841 M338V probably benign Het
Muc4 T C 16: 32,736,336 probably benign Het
Nectin3 C A 16: 46,448,590 R483L probably benign Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Ntng1 A G 3: 109,934,996 S154P probably damaging Het
Olfml2b T C 1: 170,669,222 I474T probably benign Het
Olfr1054 C G 2: 86,333,300 D19H probably benign Het
Olfr843 T C 9: 19,249,229 T57A probably damaging Het
Optc G T 1: 133,903,754 T138K possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pard3 C T 8: 127,398,627 P421S probably benign Het
Pcdhb22 G T 18: 37,520,421 E647D probably benign Het
Pclo A G 5: 14,679,992 probably benign Het
Prkce G T 17: 86,490,750 probably null Het
Prr12 T C 7: 45,048,523 D656G unknown Het
Ptprk A T 10: 28,466,052 D485V probably damaging Het
Ptprn2 T C 12: 116,876,000 L381P probably damaging Het
Rnf144b T C 13: 47,207,537 I51T probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Sh3glb2 A T 2: 30,350,699 V118E probably damaging Het
Sipa1l2 C T 8: 125,492,424 G58D probably damaging Het
Slc5a4a C T 10: 76,148,362 A46V probably damaging Het
Tepp T A 8: 95,313,010 Y18* probably null Het
Tgm7 C A 2: 121,098,588 probably null Het
Tjap1 A G 17: 46,258,792 V424A probably benign Het
Trpm6 A T 19: 18,796,500 I414F probably damaging Het
Tsr3 C G 17: 25,241,749 D196E probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Vmn2r97 T A 17: 18,929,071 N240K probably benign Het
Xdh C A 17: 73,898,344 G1042V probably damaging Het
Other mutations in Zcchc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Zcchc4 APN 5 52816169 missense probably benign 0.05
IGL00953:Zcchc4 APN 5 52808296 missense probably damaging 1.00
IGL01860:Zcchc4 APN 5 52808356 missense probably damaging 1.00
IGL02248:Zcchc4 APN 5 52796076 missense probably damaging 1.00
IGL02536:Zcchc4 APN 5 52808316 missense probably damaging 1.00
R0060:Zcchc4 UTSW 5 52807078 missense possibly damaging 0.67
R0060:Zcchc4 UTSW 5 52807078 missense possibly damaging 0.67
R0573:Zcchc4 UTSW 5 52795979 missense probably damaging 1.00
R0634:Zcchc4 UTSW 5 52783208 missense probably benign 0.15
R1353:Zcchc4 UTSW 5 52807077 missense probably benign 0.03
R1791:Zcchc4 UTSW 5 52796590 missense probably damaging 1.00
R1854:Zcchc4 UTSW 5 52815826 missense probably damaging 1.00
R2108:Zcchc4 UTSW 5 52796132 missense probably damaging 0.99
R2696:Zcchc4 UTSW 5 52796231 missense probably damaging 1.00
R2991:Zcchc4 UTSW 5 52804438 missense probably damaging 1.00
R3894:Zcchc4 UTSW 5 52784100 missense probably damaging 1.00
R4672:Zcchc4 UTSW 5 52796605 missense probably benign 0.00
R4772:Zcchc4 UTSW 5 52796207 missense possibly damaging 0.83
R4905:Zcchc4 UTSW 5 52796650 missense probably damaging 1.00
R4954:Zcchc4 UTSW 5 52819217 missense probably damaging 1.00
R5093:Zcchc4 UTSW 5 52796610 missense probably benign 0.38
R5371:Zcchc4 UTSW 5 52785170 missense probably benign 0.19
R5401:Zcchc4 UTSW 5 52807077 missense probably benign 0.03
R5755:Zcchc4 UTSW 5 52816169 missense probably benign 0.00
R6110:Zcchc4 UTSW 5 52796144 missense possibly damaging 0.95
R6244:Zcchc4 UTSW 5 52783161 missense probably benign 0.00
R6465:Zcchc4 UTSW 5 52819276 missense probably benign 0.03
R6906:Zcchc4 UTSW 5 52823634 missense possibly damaging 0.66
R7019:Zcchc4 UTSW 5 52784033 missense probably benign 0.00
R7363:Zcchc4 UTSW 5 52785168 missense possibly damaging 0.88
R7643:Zcchc4 UTSW 5 52808293 missense possibly damaging 0.85
R8097:Zcchc4 UTSW 5 52795991 missense probably benign 0.34
R8158:Zcchc4 UTSW 5 52815918 missense probably damaging 1.00
R8372:Zcchc4 UTSW 5 52796164 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCAGTGTTGCAATGGAAGAAAATAA -3'
(R):5'- CATCTGTATCAAAGTTCAGAGTTAAGT -3'

Sequencing Primer
(F):5'- GCAGAGAAACTTGGTGTAG -3'
(R):5'- TGGTCTACAGAATCAGTTCCAGGAC -3'
Posted On2015-08-18