Incidental Mutation 'R0207:Or10al3'
ID 33430
Institutional Source Beutler Lab
Gene Symbol Or10al3
Ensembl Gene ENSMUSG00000059964
Gene Name olfactory receptor family 10 subfamily AL member 3
Synonyms GA_x6K02T2PSCP-2159633-2160598, MOR263-7, Olfr119
MMRRC Submission 038460-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.051) question?
Stock # R0207 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 38007576-38012611 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 38011949 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 129 (C129*)
Ref Sequence ENSEMBL: ENSMUSP00000150099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080483] [ENSMUST00000213732]
AlphaFold Q7TRJ5
Predicted Effect probably null
Transcript: ENSMUST00000080483
AA Change: C129*
SMART Domains Protein: ENSMUSP00000092919
Gene: ENSMUSG00000059964
AA Change: C129*

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 5.6e-59 PFAM
Pfam:7TM_GPCR_Srsx 41 311 1.7e-5 PFAM
Pfam:7tm_1 47 296 3.1e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213732
AA Change: C129*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.5%
Validation Efficiency 95% (76/80)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,086,039 (GRCm39) F488S probably damaging Het
Acap3 C T 4: 155,983,881 (GRCm39) R116W probably damaging Het
Adamts10 C A 17: 33,764,364 (GRCm39) P663T possibly damaging Het
Akap12 G A 10: 4,303,333 (GRCm39) G48S probably damaging Het
Ankrd7 T A 6: 18,870,030 (GRCm39) M261K probably benign Het
Ankzf1 C A 1: 75,174,948 (GRCm39) D599E possibly damaging Het
Aox1 T C 1: 58,144,173 (GRCm39) I1278T possibly damaging Het
Apcdd1 T C 18: 63,083,150 (GRCm39) Y327H probably benign Het
Asxl3 T A 18: 22,544,553 (GRCm39) probably benign Het
Birc6 C A 17: 74,969,827 (GRCm39) probably benign Het
Btaf1 T A 19: 36,987,048 (GRCm39) L1714* probably null Het
Cacng6 T A 7: 3,473,520 (GRCm39) probably benign Het
Cdc20b A G 13: 113,215,146 (GRCm39) D238G probably damaging Het
Celf5 T A 10: 81,306,532 (GRCm39) R113W probably null Het
Cfap251 T C 5: 123,421,510 (GRCm39) V182A probably damaging Het
Cfap70 C A 14: 20,462,415 (GRCm39) E659D probably damaging Het
Clspn T A 4: 126,484,391 (GRCm39) M1183K possibly damaging Het
Dpy19l1 G A 9: 24,365,187 (GRCm39) R275C probably damaging Het
Dst C T 1: 34,226,016 (GRCm39) S1721L probably benign Het
Faap100 T C 11: 120,265,191 (GRCm39) T562A probably damaging Het
Fam168b T C 1: 34,858,769 (GRCm39) M133V probably damaging Het
Farp2 T C 1: 93,496,809 (GRCm39) I172T probably damaging Het
Fer T G 17: 64,203,273 (GRCm39) S68A probably damaging Het
Fmo5 A G 3: 97,552,997 (GRCm39) E315G probably damaging Het
Gpr89 A T 3: 96,778,796 (GRCm39) F426I probably damaging Het
Hinfp T C 9: 44,207,624 (GRCm39) I461V possibly damaging Het
Hsd11b1 A T 1: 192,922,556 (GRCm39) V167D probably damaging Het
Htt A G 5: 35,054,252 (GRCm39) K2574E probably benign Het
I830077J02Rik A G 3: 105,833,821 (GRCm39) S112P probably benign Het
Igf2bp3 T A 6: 49,082,551 (GRCm39) M344L probably benign Het
Itch A T 2: 155,044,177 (GRCm39) Q494L probably benign Het
Itga9 T C 9: 118,598,321 (GRCm39) probably benign Het
Jaml T A 9: 45,005,065 (GRCm39) D152E probably benign Het
Kif22 A C 7: 126,641,572 (GRCm39) M1R probably null Het
Kifap3 T C 1: 163,710,955 (GRCm39) Y663H probably benign Het
Letm2 T A 8: 26,068,786 (GRCm39) N472I probably damaging Het
Mthfr T G 4: 148,136,681 (GRCm39) V446G probably damaging Het
Myh11 T C 16: 14,029,124 (GRCm39) E1206G possibly damaging Het
Myo6 G A 9: 80,195,338 (GRCm39) V903I probably damaging Het
Myo9b C T 8: 71,807,869 (GRCm39) probably benign Het
Nr2f2 G C 7: 70,009,923 (GRCm39) P52R probably damaging Het
Nsd3 A G 8: 26,173,273 (GRCm39) N859S probably benign Het
Nucb2 C A 7: 116,135,245 (GRCm39) A384E probably damaging Het
Ogdhl C A 14: 32,063,994 (GRCm39) probably null Het
Or1e22 A T 11: 73,377,401 (GRCm39) L83Q probably benign Het
Or1i2 T C 10: 78,447,705 (GRCm39) T257A probably benign Het
Or4a74 G A 2: 89,440,207 (GRCm39) L80F probably damaging Het
Or5b105 G A 19: 13,080,642 (GRCm39) R3C possibly damaging Het
Parp10 C T 15: 76,126,833 (GRCm39) S145N probably benign Het
Pigh A G 12: 79,130,483 (GRCm39) probably benign Het
Pigo A G 4: 43,023,824 (GRCm39) probably benign Het
Pkp4 T A 2: 59,135,832 (GRCm39) V199D possibly damaging Het
Polr1e C A 4: 45,025,143 (GRCm39) probably null Het
Ppfia3 C A 7: 44,997,958 (GRCm39) R723L probably damaging Het
Prex1 C A 2: 166,427,818 (GRCm39) A945S possibly damaging Het
Prrt3 A T 6: 113,472,801 (GRCm39) V457E probably damaging Het
Rab39 A G 9: 53,617,271 (GRCm39) F49L possibly damaging Het
Rrs1 C A 1: 9,615,987 (GRCm39) probably null Het
Rrs1 G A 1: 9,615,992 (GRCm39) E82K probably damaging Het
Serpinb3c T C 1: 107,204,722 (GRCm39) D8G probably benign Het
Slc17a6 A G 7: 51,295,928 (GRCm39) probably benign Het
Slc24a4 T A 12: 102,195,210 (GRCm39) probably null Het
Smc1b C T 15: 85,007,960 (GRCm39) M272I probably benign Het
Smc6 T C 12: 11,333,179 (GRCm39) probably benign Het
Tcf20 T C 15: 82,739,286 (GRCm39) T722A probably benign Het
Tesmin A T 19: 3,454,088 (GRCm39) M141L probably benign Het
Tmprss5 T A 9: 49,024,460 (GRCm39) H274Q possibly damaging Het
Tns1 C T 1: 73,976,477 (GRCm39) probably null Het
Tpr T C 1: 150,293,178 (GRCm39) S868P possibly damaging Het
Trank1 C T 9: 111,195,321 (GRCm39) T1115I probably damaging Het
Trmt44 A T 5: 35,730,261 (GRCm39) I203K possibly damaging Het
Ulk2 A T 11: 61,668,611 (GRCm39) V1037E probably benign Het
Usp43 A G 11: 67,767,325 (GRCm39) Y682H probably damaging Het
Vipr2 A T 12: 116,106,502 (GRCm39) Q366L probably damaging Het
Vmn1r185 C A 7: 26,311,014 (GRCm39) V164L possibly damaging Het
Vmn2r120 C T 17: 57,832,052 (GRCm39) V246I probably benign Het
Wiz C T 17: 32,576,007 (GRCm39) G790R probably damaging Het
Wnk1 A T 6: 119,929,694 (GRCm39) S1016R probably damaging Het
Zc3hav1 A G 6: 38,288,109 (GRCm39) L909S probably benign Het
Zfp236 T A 18: 82,658,352 (GRCm39) I637F probably damaging Het
Zfp788 G A 7: 41,299,020 (GRCm39) G532D probably damaging Het
Zranb1 T C 7: 132,552,114 (GRCm39) I255T probably damaging Het
Other mutations in Or10al3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02209:Or10al3 APN 17 38,011,883 (GRCm39) missense probably damaging 1.00
IGL03339:Or10al3 APN 17 38,011,682 (GRCm39) missense probably damaging 0.99
R0092:Or10al3 UTSW 17 38,011,696 (GRCm39) missense probably damaging 0.98
R0378:Or10al3 UTSW 17 38,011,932 (GRCm39) missense probably damaging 1.00
R0408:Or10al3 UTSW 17 38,012,190 (GRCm39) missense probably benign
R0483:Or10al3 UTSW 17 38,012,188 (GRCm39) missense probably benign 0.01
R1595:Or10al3 UTSW 17 38,012,004 (GRCm39) missense probably benign 0.03
R1901:Or10al3 UTSW 17 38,012,312 (GRCm39) missense probably damaging 1.00
R1902:Or10al3 UTSW 17 38,012,312 (GRCm39) missense probably damaging 1.00
R2845:Or10al3 UTSW 17 38,011,714 (GRCm39) missense probably damaging 1.00
R2846:Or10al3 UTSW 17 38,011,714 (GRCm39) missense probably damaging 1.00
R4356:Or10al3 UTSW 17 38,011,790 (GRCm39) missense probably damaging 0.97
R4381:Or10al3 UTSW 17 38,011,790 (GRCm39) missense probably damaging 0.97
R6744:Or10al3 UTSW 17 38,012,336 (GRCm39) nonsense probably null
R7674:Or10al3 UTSW 17 38,011,573 (GRCm39) missense probably benign 0.03
R7677:Or10al3 UTSW 17 38,011,957 (GRCm39) missense probably damaging 1.00
R7994:Or10al3 UTSW 17 38,012,326 (GRCm39) missense probably damaging 0.99
R8305:Or10al3 UTSW 17 38,012,389 (GRCm39) missense probably benign 0.10
R8512:Or10al3 UTSW 17 38,012,071 (GRCm39) missense probably damaging 1.00
R9300:Or10al3 UTSW 17 38,011,815 (GRCm39) missense probably damaging 1.00
R9760:Or10al3 UTSW 17 38,012,434 (GRCm39) missense probably damaging 1.00
Z1177:Or10al3 UTSW 17 38,011,944 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACTGACAGGAAATGCACTCATAGCC -3'
(R):5'- AGATATGCAGAGAACTGCTGCCAC -3'

Sequencing Primer
(F):5'- GAAATGCACTCATAGCCCTTGTC -3'
(R):5'- TGTATCTCCACAGGCAAGTG -3'
Posted On 2013-05-09