Mutagenetix > Incidental Mutations

Incidental Mutation 'R4523:Gak'

334302

Institutional Source

Beutler Lab

Gene Symbol

Gak

Ensembl Gene

ENSMUSG00000062234

Gene Name

cyclin G associated kinase

Synonyms

D130045N16Rik

MMRRC Submission

042004-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4523 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108569411-108629755 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 108576566 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 1093 (Q1093K)

Ref Sequence

ENSEMBL: ENSMUSP00000036705 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046603] [ENSMUST00000135225] [ENSMUST00000145467] [ENSMUST00000199048]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000046603
AA Change: Q1093K

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000036705
Gene: ENSMUSG00000062234
AA Change: Q1093K

Domain	Start	End	E-Value	Type
low complexity region	11	22	N/A	INTRINSIC
Pfam:Pkinase	40	313	1.6e-49	PFAM
Pfam:Pkinase_Tyr	40	313	3e-30	PFAM
PTEN_C2	568	707	1.43e-44	SMART
low complexity region	819	833	N/A	INTRINSIC
low complexity region	932	945	N/A	INTRINSIC
low complexity region	1084	1092	N/A	INTRINSIC
low complexity region	1094	1110	N/A	INTRINSIC
DnaJ	1240	1301	2.3e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133745

Predicted Effect

probably benign
Transcript: ENSMUST00000135225

SMART Domains

Protein: ENSMUSP00000118008
Gene: ENSMUSG00000062234

Domain	Start	End	E-Value	Type
low complexity region	11	22	N/A	INTRINSIC
Pfam:Pkinase	40	128	7.9e-11	PFAM
Pfam:Pkinase_Tyr	40	128	1.2e-6	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137872

Predicted Effect

probably benign
Transcript: ENSMUST00000145467

SMART Domains

Protein: ENSMUSP00000118713
Gene: ENSMUSG00000062234

Domain	Start	End	E-Value	Type
low complexity region	11	22	N/A	INTRINSIC
Pfam:Pkinase	40	128	7.9e-11	PFAM
Pfam:Pkinase_Tyr	40	128	1.2e-6	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000156110
AA Change: Q395K

SMART Domains

Protein: ENSMUSP00000115184
Gene: ENSMUSG00000062234
AA Change: Q395K

Domain	Start	End	E-Value	Type
Pfam:PTEN_C2	4	59	9.5e-14	PFAM
low complexity region	122	136	N/A	INTRINSIC
low complexity region	235	248	N/A	INTRINSIC
low complexity region	387	395	N/A	INTRINSIC
low complexity region	397	413	N/A	INTRINSIC
DnaJ	543	604	2.3e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196010

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199010

Predicted Effect

probably benign
Transcript: ENSMUST00000199048

SMART Domains

Protein: ENSMUSP00000142931
Gene: ENSMUSG00000062234

Domain	Start	End	E-Value	Type
low complexity region	11	22	N/A	INTRINSIC
PDB:4O38\|B	23	69	3e-10	PDB
SCOP:d1koba_	41	69	3e-5	SMART

Meta Mutation Damage Score

0.0714

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In all eukaryotes, the cell cycle is governed by cyclin-dependent protein kinases (CDKs), whose activities are regulated by cyclins and CDK inhibitors in a diverse array of mechanisms that involve the control of phosphorylation and dephosphorylation of Ser, Thr or Tyr residues. Cyclins are molecules that possess a consensus domain called the 'cyclin box.' In mammalian cells, 9 cyclin species have been identified, and they are referred to as cyclins A through I. Cyclin G is a direct transcriptional target of the p53 tumor suppressor gene product and thus functions downstream of p53. GAK is an association partner of cyclin G and CDK5. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a deletion of the kinase domain display neonatal lethality with abnormal lung alveolar morphology and development. Mice homozygous for a knock-out allele exhibit lethality during early development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp8a1	G	T	5: 67,667,600	T796K	probably benign	Het
Atr	T	C	9: 95,862,863	S78P	probably damaging	Het
BC017643	A	G	11: 121,224,108		probably benign	Het
Calb2	C	T	8: 110,148,509		probably null	Het
Ccdc88c	G	T	12: 100,913,332	S1843R	possibly damaging	Het
Cdca7	A	G	2: 72,479,698	S77G	probably damaging	Het
Cnot2	C	T	10: 116,581,474		probably benign	Het
Cstf2t	T	A	19: 31,083,082	V6D	possibly damaging	Het
Dido1	T	C	2: 180,672,292	I852V	probably damaging	Het
Dmgdh	C	T	13: 93,688,630	Q154*	probably null	Het
Dnah12	T	C	14: 26,770,022	F1138S	probably damaging	Het
Dnah12	G	A	14: 26,876,958	A998T	possibly damaging	Het
Dusp5	T	G	19: 53,537,601	Y225D	probably damaging	Het
Fam122c	G	A	X: 53,293,499	R94H	possibly damaging	Het
Fam126a	T	C	5: 23,965,122	T410A	probably benign	Het
Fam193a	G	A	5: 34,443,371	D601N	probably benign	Het
Fbxo41	A	G	6: 85,484,042	I228T	probably damaging	Het
Fmo2	T	C	1: 162,887,708	K115R	probably benign	Het
Gm5277	G	T	3: 78,892,186		noncoding transcript	Het
Gm7173	A	T	X: 79,509,995	N291K	possibly damaging	Het
Hgsnat	A	G	8: 25,968,361		probably null	Het
Map3k3	G	A	11: 106,148,868	R278H	probably damaging	Het
Mrvi1	T	C	7: 110,923,841	M338V	probably benign	Het
Muc4	T	C	16: 32,736,336		probably benign	Het
Nectin3	C	A	16: 46,448,590	R483L	probably benign	Het
Nop2	G	T	6: 125,133,552	R47L	probably damaging	Het
Ntng1	A	G	3: 109,934,996	S154P	probably damaging	Het
Olfml2b	T	C	1: 170,669,222	I474T	probably benign	Het
Olfr1054	C	G	2: 86,333,300	D19H	probably benign	Het
Olfr843	T	C	9: 19,249,229	T57A	probably damaging	Het
Optc	G	T	1: 133,903,754	T138K	possibly damaging	Het
Orc4	G	A	2: 48,937,489	P31S	probably benign	Het
Pard3	C	T	8: 127,398,627	P421S	probably benign	Het
Pcdhb22	G	T	18: 37,520,421	E647D	probably benign	Het
Pclo	A	G	5: 14,679,992		probably benign	Het
Prkce	G	T	17: 86,490,750		probably null	Het
Prr12	T	C	7: 45,048,523	D656G	unknown	Het
Ptprk	A	T	10: 28,466,052	D485V	probably damaging	Het
Ptprn2	T	C	12: 116,876,000	L381P	probably damaging	Het
Rnf144b	T	C	13: 47,207,537	I51T	probably benign	Het
Rpl10l	T	C	12: 66,283,738	D207G	probably benign	Het
Sh3glb2	A	T	2: 30,350,699	V118E	probably damaging	Het
Sipa1l2	C	T	8: 125,492,424	G58D	probably damaging	Het
Slc5a4a	C	T	10: 76,148,362	A46V	probably damaging	Het
Tepp	T	A	8: 95,313,010	Y18*	probably null	Het
Tgm7	C	A	2: 121,098,588		probably null	Het
Tjap1	A	G	17: 46,258,792	V424A	probably benign	Het
Trpm6	A	T	19: 18,796,500	I414F	probably damaging	Het
Tsr3	C	G	17: 25,241,749	D196E	probably benign	Het
Ubqlnl	C	T	7: 104,149,718	V191M	probably benign	Het
Vmn2r72	T	A	7: 85,751,926	H95L	probably benign	Het
Vmn2r97	T	A	17: 18,929,071	N240K	probably benign	Het
Xdh	C	A	17: 73,898,344	G1042V	probably damaging	Het
Zcchc4	A	G	5: 52,784,067	D68G	probably damaging	Het

Other mutations in Gak

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00694:Gak	APN	5	108613634	makesense	probably null
IGL00768:Gak	APN	5	108576654	missense	probably benign
IGL01128:Gak	APN	5	108592370	missense	probably damaging	0.97
IGL01557:Gak	APN	5	108584337	missense	probably damaging	1.00
IGL02559:Gak	APN	5	108584232	missense	probably null	0.07
PIT4449001:Gak	UTSW	5	108580925	missense	probably benign	0.00
R0030:Gak	UTSW	5	108613547	nonsense	probably null
R1403:Gak	UTSW	5	108591145	missense	probably damaging	1.00
R1403:Gak	UTSW	5	108591145	missense	probably damaging	1.00
R1530:Gak	UTSW	5	108624193	missense	probably damaging	0.97
R1646:Gak	UTSW	5	108602854	missense	probably damaging	1.00
R1699:Gak	UTSW	5	108604377	nonsense	probably null
R1702:Gak	UTSW	5	108606376	splice site	probably null
R1732:Gak	UTSW	5	108576582	missense	probably benign	0.28
R1738:Gak	UTSW	5	108616976	missense	probably damaging	1.00
R1772:Gak	UTSW	5	108606892	missense	probably damaging	1.00
R1792:Gak	UTSW	5	108585531	nonsense	probably null
R2068:Gak	UTSW	5	108570225	missense	probably benign
R2137:Gak	UTSW	5	108606877	splice site	probably null
R2138:Gak	UTSW	5	108606877	splice site	probably null
R2139:Gak	UTSW	5	108606877	splice site	probably null
R2904:Gak	UTSW	5	108624214	missense	possibly damaging	0.70
R3080:Gak	UTSW	5	108613602	missense	possibly damaging	0.90
R3773:Gak	UTSW	5	108582672	missense	probably benign	0.00
R4665:Gak	UTSW	5	108582960	missense	probably benign
R4703:Gak	UTSW	5	108569877	missense	probably damaging	0.99
R4890:Gak	UTSW	5	108580876	unclassified	probably benign
R4951:Gak	UTSW	5	108582718	missense	probably benign
R4971:Gak	UTSW	5	108596806	missense	probably damaging	1.00
R5328:Gak	UTSW	5	108617001	missense	possibly damaging	0.94
R5436:Gak	UTSW	5	108592352	missense	possibly damaging	0.94
R5496:Gak	UTSW	5	108576617	missense	probably benign	0.00
R6207:Gak	UTSW	5	108625029	critical splice donor site	probably null
R6359:Gak	UTSW	5	108571900	missense	probably damaging	1.00
R6468:Gak	UTSW	5	108623336	nonsense	probably null
R6682:Gak	UTSW	5	108598876	missense	probably damaging	1.00
R6915:Gak	UTSW	5	108602950	missense	probably benign	0.20
R7403:Gak	UTSW	5	108613535	missense	probably benign	0.00
R7458:Gak	UTSW	5	108583074	missense	probably benign	0.00
R7522:Gak	UTSW	5	108591199	missense	possibly damaging	0.95
R7650:Gak	UTSW	5	108584295	missense	probably benign	0.00
R7737:Gak	UTSW	5	108617008	missense	probably benign	0.15
R8437:Gak	UTSW	5	108609406	missense	probably benign	0.30
R8739:Gak	UTSW	5	108591738	missense	possibly damaging	0.65
R8954:Gak	UTSW	5	108629652	start gained	probably benign
X0064:Gak	UTSW	5	108613533	nonsense	probably null
Z1177:Gak	UTSW	5	108585352	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TGGAATTAGCTAGGACAGATACTGC -3'
(R):5'- TACCAAACCTTGAGTGGGGC -3'

Sequencing Primer
(F):5'- TTAGCTAGGACAGATACTGCATGGTC -3'
(R):5'- CAAACCTTGAGTGGGGCCTTTG -3'

Posted On

2015-08-18