Incidental Mutation 'R4523:Hgsnat'
ID334309
Institutional Source Beutler Lab
Gene Symbol Hgsnat
Ensembl Gene ENSMUSG00000037260
Gene Nameheparan-alpha-glucosaminide N-acetyltransferase
SynonymsD8Ertd354e, 9430010M12Rik, Tmem76
MMRRC Submission 042004-MU
Accession Numbers

Ncbi RefSeq: NM_029884.1; MGI:1196297

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4523 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location25944453-25976753 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 25968361 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000040356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037609] [ENSMUST00000211550]
Predicted Effect probably null
Transcript: ENSMUST00000037609
SMART Domains Protein: ENSMUSP00000040356
Gene: ENSMUSG00000037260

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
Pfam:DUF1624 260 434 6.8e-11 PFAM
Pfam:DUF5009 286 389 2.4e-10 PFAM
transmembrane domain 494 516 N/A INTRINSIC
transmembrane domain 523 545 N/A INTRINSIC
transmembrane domain 560 582 N/A INTRINSIC
transmembrane domain 587 609 N/A INTRINSIC
transmembrane domain 629 648 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209420
Predicted Effect probably benign
Transcript: ENSMUST00000211550
Meta Mutation Damage Score 0.9494 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lysosomal acetyltransferase, which is one of several enzymes involved in the lysosomal degradation of heparin sulfate. Mutations in this gene are associated with Sanfilippo syndrome C, one type of the lysosomal storage disease mucopolysaccaridosis III, which results from impaired degradation of heparan sulfate. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit progressive storage pathology in the CNS and peripheral organs, glycosaminoglycan accumulation in brain and most somatic organs, lysosomal distension and dysfunction, astrocytosis, microgliosis, hepatosplenomegaly, behavioral deficits and premature death. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(3) Gene trapped(6)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8a1 G T 5: 67,667,600 T796K probably benign Het
Atr T C 9: 95,862,863 S78P probably damaging Het
BC017643 A G 11: 121,224,108 probably benign Het
Calb2 C T 8: 110,148,509 probably null Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cdca7 A G 2: 72,479,698 S77G probably damaging Het
Cnot2 C T 10: 116,581,474 probably benign Het
Cstf2t T A 19: 31,083,082 V6D possibly damaging Het
Dido1 T C 2: 180,672,292 I852V probably damaging Het
Dmgdh C T 13: 93,688,630 Q154* probably null Het
Dnah12 T C 14: 26,770,022 F1138S probably damaging Het
Dnah12 G A 14: 26,876,958 A998T possibly damaging Het
Dusp5 T G 19: 53,537,601 Y225D probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam126a T C 5: 23,965,122 T410A probably benign Het
Fam193a G A 5: 34,443,371 D601N probably benign Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Fmo2 T C 1: 162,887,708 K115R probably benign Het
Gak G T 5: 108,576,566 Q1093K probably benign Het
Gm5277 G T 3: 78,892,186 noncoding transcript Het
Gm7173 A T X: 79,509,995 N291K possibly damaging Het
Map3k3 G A 11: 106,148,868 R278H probably damaging Het
Mrvi1 T C 7: 110,923,841 M338V probably benign Het
Muc4 T C 16: 32,736,336 probably benign Het
Nectin3 C A 16: 46,448,590 R483L probably benign Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Ntng1 A G 3: 109,934,996 S154P probably damaging Het
Olfml2b T C 1: 170,669,222 I474T probably benign Het
Olfr1054 C G 2: 86,333,300 D19H probably benign Het
Olfr843 T C 9: 19,249,229 T57A probably damaging Het
Optc G T 1: 133,903,754 T138K possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pard3 C T 8: 127,398,627 P421S probably benign Het
Pcdhb22 G T 18: 37,520,421 E647D probably benign Het
Pclo A G 5: 14,679,992 probably benign Het
Prkce G T 17: 86,490,750 probably null Het
Prr12 T C 7: 45,048,523 D656G unknown Het
Ptprk A T 10: 28,466,052 D485V probably damaging Het
Ptprn2 T C 12: 116,876,000 L381P probably damaging Het
Rnf144b T C 13: 47,207,537 I51T probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Sh3glb2 A T 2: 30,350,699 V118E probably damaging Het
Sipa1l2 C T 8: 125,492,424 G58D probably damaging Het
Slc5a4a C T 10: 76,148,362 A46V probably damaging Het
Tepp T A 8: 95,313,010 Y18* probably null Het
Tgm7 C A 2: 121,098,588 probably null Het
Tjap1 A G 17: 46,258,792 V424A probably benign Het
Trpm6 A T 19: 18,796,500 I414F probably damaging Het
Tsr3 C G 17: 25,241,749 D196E probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Vmn2r97 T A 17: 18,929,071 N240K probably benign Het
Xdh C A 17: 73,898,344 G1042V probably damaging Het
Zcchc4 A G 5: 52,784,067 D68G probably damaging Het
Other mutations in Hgsnat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Hgsnat APN 8 25972937 missense probably benign 0.04
IGL02950:Hgsnat APN 8 25971701 missense probably damaging 1.00
IGL03145:Hgsnat APN 8 25946452 missense probably damaging 1.00
ample UTSW 8 25947960 nonsense probably null
generous UTSW 8 25968361 critical splice donor site probably null
P0018:Hgsnat UTSW 8 25968354 unclassified probably benign
PIT4305001:Hgsnat UTSW 8 25945199 missense possibly damaging 0.67
R1396:Hgsnat UTSW 8 25957335 missense possibly damaging 0.95
R1676:Hgsnat UTSW 8 25954605 critical splice donor site probably null
R1856:Hgsnat UTSW 8 25957256 missense probably benign 0.06
R1998:Hgsnat UTSW 8 25945252 nonsense probably null
R2497:Hgsnat UTSW 8 25945252 nonsense probably null
R2570:Hgsnat UTSW 8 25945252 nonsense probably null
R4012:Hgsnat UTSW 8 25955789 nonsense probably null
R4080:Hgsnat UTSW 8 25946343 missense probably benign 0.02
R4462:Hgsnat UTSW 8 25954636 missense probably damaging 1.00
R4914:Hgsnat UTSW 8 25964838 missense probably damaging 0.98
R5010:Hgsnat UTSW 8 25947960 nonsense probably null
R5561:Hgsnat UTSW 8 25946334 missense possibly damaging 0.90
R5889:Hgsnat UTSW 8 25963367 missense probably damaging 1.00
R6411:Hgsnat UTSW 8 25946275 missense possibly damaging 0.88
R6520:Hgsnat UTSW 8 25953300 missense probably damaging 1.00
R6524:Hgsnat UTSW 8 25945232 missense probably damaging 1.00
R7230:Hgsnat UTSW 8 25954832 splice site probably null
R7462:Hgsnat UTSW 8 25957213 missense probably benign 0.45
R7509:Hgsnat UTSW 8 25955726 missense probably damaging 0.98
R7526:Hgsnat UTSW 8 25971049 missense probably damaging 1.00
R7583:Hgsnat UTSW 8 25971564 critical splice donor site probably null
R7679:Hgsnat UTSW 8 25954637 missense probably damaging 1.00
R8111:Hgsnat UTSW 8 25968412 missense probably benign 0.00
R8206:Hgsnat UTSW 8 25954637 missense probably damaging 1.00
R8321:Hgsnat UTSW 8 25971151 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGGAATAGAACCGTCATGGC -3'
(R):5'- TCCTGCTTCCTCACACAGAG -3'

Sequencing Primer
(F):5'- GTCATGGCGGATGTACAAATCCTAC -3'
(R):5'- GCTTCCTCACACAGAGTTTAACATGG -3'
Posted On2015-08-18