Incidental Mutation 'R4523:Calb2'
ID334311
Institutional Source Beutler Lab
Gene Symbol Calb2
Ensembl Gene ENSMUSG00000003657
Gene Namecalbindin 2
SynonymsCR, calretinin
MMRRC Submission 042004-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.290) question?
Stock #R4523 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location110137502-110168210 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 110148509 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003754] [ENSMUST00000212297]
Predicted Effect probably null
Transcript: ENSMUST00000003754
SMART Domains Protein: ENSMUSP00000003754
Gene: ENSMUSG00000003657

DomainStartEndE-ValueType
EFh 20 48 3.22e-5 SMART
EFh 67 95 1.25e-2 SMART
EFh 111 139 2.01e-6 SMART
EFh 155 183 1.87e0 SMART
EFh 199 227 4.96e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000212297
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular calcium-binding protein belonging to the troponin C superfamily. Members of this protein family have six EF-hand domains which bind calcium. This protein plays a role in diverse cellular functions, including message targeting and intracellular calcium buffering. It also functions as a modulator of neuronal excitability, and is a diagnostic marker for some human diseases, including Hirschsprung disease and some cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygous targeted mutants showed normal growth, normal brain histology, and generally normal behavior. Impaired motor coordination was observed in wheel running in young and old mutant mice, and progressive impairment was seen on the runway and horizontal stationary rod tests in older mice. Abnormalities are observed in Purkinje cell firing, altering both simple and complex spikes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8a1 G T 5: 67,667,600 T796K probably benign Het
Atr T C 9: 95,862,863 S78P probably damaging Het
BC017643 A G 11: 121,224,108 probably benign Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cdca7 A G 2: 72,479,698 S77G probably damaging Het
Cnot2 C T 10: 116,581,474 probably benign Het
Cstf2t T A 19: 31,083,082 V6D possibly damaging Het
Dido1 T C 2: 180,672,292 I852V probably damaging Het
Dmgdh C T 13: 93,688,630 Q154* probably null Het
Dnah12 T C 14: 26,770,022 F1138S probably damaging Het
Dnah12 G A 14: 26,876,958 A998T possibly damaging Het
Dusp5 T G 19: 53,537,601 Y225D probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam126a T C 5: 23,965,122 T410A probably benign Het
Fam193a G A 5: 34,443,371 D601N probably benign Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Fmo2 T C 1: 162,887,708 K115R probably benign Het
Gak G T 5: 108,576,566 Q1093K probably benign Het
Gm5277 G T 3: 78,892,186 noncoding transcript Het
Gm7173 A T X: 79,509,995 N291K possibly damaging Het
Hgsnat A G 8: 25,968,361 probably null Het
Map3k3 G A 11: 106,148,868 R278H probably damaging Het
Mrvi1 T C 7: 110,923,841 M338V probably benign Het
Muc4 T C 16: 32,736,336 probably benign Het
Nectin3 C A 16: 46,448,590 R483L probably benign Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Ntng1 A G 3: 109,934,996 S154P probably damaging Het
Olfml2b T C 1: 170,669,222 I474T probably benign Het
Olfr1054 C G 2: 86,333,300 D19H probably benign Het
Olfr843 T C 9: 19,249,229 T57A probably damaging Het
Optc G T 1: 133,903,754 T138K possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pard3 C T 8: 127,398,627 P421S probably benign Het
Pcdhb22 G T 18: 37,520,421 E647D probably benign Het
Pclo A G 5: 14,679,992 probably benign Het
Prkce G T 17: 86,490,750 probably null Het
Prr12 T C 7: 45,048,523 D656G unknown Het
Ptprk A T 10: 28,466,052 D485V probably damaging Het
Ptprn2 T C 12: 116,876,000 L381P probably damaging Het
Rnf144b T C 13: 47,207,537 I51T probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Sh3glb2 A T 2: 30,350,699 V118E probably damaging Het
Sipa1l2 C T 8: 125,492,424 G58D probably damaging Het
Slc5a4a C T 10: 76,148,362 A46V probably damaging Het
Tepp T A 8: 95,313,010 Y18* probably null Het
Tgm7 C A 2: 121,098,588 probably null Het
Tjap1 A G 17: 46,258,792 V424A probably benign Het
Trpm6 A T 19: 18,796,500 I414F probably damaging Het
Tsr3 C G 17: 25,241,749 D196E probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Vmn2r97 T A 17: 18,929,071 N240K probably benign Het
Xdh C A 17: 73,898,344 G1042V probably damaging Het
Zcchc4 A G 5: 52,784,067 D68G probably damaging Het
Other mutations in Calb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Calb2 APN 8 110145671 missense probably damaging 1.00
IGL02604:Calb2 APN 8 110148528 missense probably damaging 1.00
IGL03250:Calb2 APN 8 110143107 missense probably benign 0.09
R1108:Calb2 UTSW 8 110143128 nonsense probably null
R2007:Calb2 UTSW 8 110168070 missense probably benign 0.40
R3195:Calb2 UTSW 8 110157003 splice site probably benign
R3683:Calb2 UTSW 8 110156988 missense probably benign 0.07
R3684:Calb2 UTSW 8 110156988 missense probably benign 0.07
R4661:Calb2 UTSW 8 110168077 missense probably benign 0.04
R4662:Calb2 UTSW 8 110168077 missense probably benign 0.04
R5326:Calb2 UTSW 8 110156978 missense possibly damaging 0.83
R5566:Calb2 UTSW 8 110152700 missense possibly damaging 0.85
R8289:Calb2 UTSW 8 110168058 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- CTGGAGATTTATGAGTTCCCATGG -3'
(R):5'- GCAAGCTGTGTAATTGGTAGAGC -3'

Sequencing Primer
(F):5'- TGGAAACAGAGAACCCCCAAGTC -3'
(R):5'- GTCTGACCTCCTGAAGAA -3'
Posted On2015-08-18