Incidental Mutation 'R4523:Sipa1l2'
ID 334312
Institutional Source Beutler Lab
Gene Symbol Sipa1l2
Ensembl Gene ENSMUSG00000001995
Gene Name signal-induced proliferation-associated 1 like 2
Synonyms
MMRRC Submission 042004-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.318) question?
Stock # R4523 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 126144802-126296547 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 126219163 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 58 (G58D)
Ref Sequence ENSEMBL: ENSMUSP00000148557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108775] [ENSMUST00000212168] [ENSMUST00000212987]
AlphaFold Q80TE4
Predicted Effect probably damaging
Transcript: ENSMUST00000108775
AA Change: G58D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104405
Gene: ENSMUSG00000001995
AA Change: G58D

DomainStartEndE-ValueType
low complexity region 53 64 N/A INTRINSIC
low complexity region 163 172 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
low complexity region 427 449 N/A INTRINSIC
Pfam:Rap_GAP 625 807 2.6e-67 PFAM
PDZ 960 1026 6.47e-9 SMART
low complexity region 1091 1103 N/A INTRINSIC
low complexity region 1120 1138 N/A INTRINSIC
low complexity region 1220 1238 N/A INTRINSIC
low complexity region 1299 1312 N/A INTRINSIC
low complexity region 1321 1329 N/A INTRINSIC
low complexity region 1334 1355 N/A INTRINSIC
low complexity region 1404 1418 N/A INTRINSIC
Pfam:SPAR_C 1421 1666 2.5e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212168
AA Change: G58D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000212987
AA Change: G58D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal-induced proliferation-associated 1 like family. Members of this family contain a GTPase activating domain, a PDZ domain and a C-terminal coiled-coil domain with a leucine zipper. A similar protein in rat acts as a GTPases for the small GTPase Rap. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8a1 G T 5: 67,824,943 (GRCm39) T796K probably benign Het
Atr T C 9: 95,744,916 (GRCm39) S78P probably damaging Het
Calb2 C T 8: 110,875,141 (GRCm39) probably null Het
Ccdc88c G T 12: 100,879,591 (GRCm39) S1843R possibly damaging Het
Cdca7 A G 2: 72,310,042 (GRCm39) S77G probably damaging Het
Cfap47 A T X: 78,553,601 (GRCm39) N291K possibly damaging Het
Cnot2 C T 10: 116,417,379 (GRCm39) probably benign Het
Cstf2t T A 19: 31,060,482 (GRCm39) V6D possibly damaging Het
Cybc1 A G 11: 121,114,934 (GRCm39) probably benign Het
Dido1 T C 2: 180,314,085 (GRCm39) I852V probably damaging Het
Dmgdh C T 13: 93,825,138 (GRCm39) Q154* probably null Het
Dnah12 T C 14: 26,491,979 (GRCm39) F1138S probably damaging Het
Dnah12 G A 14: 26,598,915 (GRCm39) A998T possibly damaging Het
Dusp5 T G 19: 53,526,032 (GRCm39) Y225D probably damaging Het
Fam193a G A 5: 34,600,715 (GRCm39) D601N probably benign Het
Fbxo41 A G 6: 85,461,024 (GRCm39) I228T probably damaging Het
Fmo2 T C 1: 162,715,277 (GRCm39) K115R probably benign Het
Gak G T 5: 108,724,432 (GRCm39) Q1093K probably benign Het
Gm5277 G T 3: 78,799,493 (GRCm39) noncoding transcript Het
Hgsnat A G 8: 26,458,389 (GRCm39) probably null Het
Hycc1 T C 5: 24,170,120 (GRCm39) T410A probably benign Het
Irag1 T C 7: 110,523,048 (GRCm39) M338V probably benign Het
Map3k3 G A 11: 106,039,694 (GRCm39) R278H probably damaging Het
Muc4 T C 16: 32,555,154 (GRCm39) probably benign Het
Nectin3 C A 16: 46,268,953 (GRCm39) R483L probably benign Het
Nop2 G T 6: 125,110,515 (GRCm39) R47L probably damaging Het
Ntng1 A G 3: 109,842,312 (GRCm39) S154P probably damaging Het
Olfml2b T C 1: 170,496,791 (GRCm39) I474T probably benign Het
Optc G T 1: 133,831,492 (GRCm39) T138K possibly damaging Het
Or7g25 T C 9: 19,160,525 (GRCm39) T57A probably damaging Het
Or8k22 C G 2: 86,163,644 (GRCm39) D19H probably benign Het
Orc4 G A 2: 48,827,501 (GRCm39) P31S probably benign Het
Pabir3 G A X: 52,382,376 (GRCm39) R94H possibly damaging Het
Pard3 C T 8: 128,125,108 (GRCm39) P421S probably benign Het
Pcdhb22 G T 18: 37,653,474 (GRCm39) E647D probably benign Het
Pclo A G 5: 14,730,006 (GRCm39) probably benign Het
Prkce G T 17: 86,798,178 (GRCm39) probably null Het
Prr12 T C 7: 44,697,947 (GRCm39) D656G unknown Het
Ptprk A T 10: 28,342,048 (GRCm39) D485V probably damaging Het
Ptprn2 T C 12: 116,839,620 (GRCm39) L381P probably damaging Het
Rnf144b T C 13: 47,361,013 (GRCm39) I51T probably benign Het
Rpl10l T C 12: 66,330,512 (GRCm39) D207G probably benign Het
Sh3glb2 A T 2: 30,240,711 (GRCm39) V118E probably damaging Het
Slc5a4a C T 10: 75,984,196 (GRCm39) A46V probably damaging Het
Spmip8 T A 8: 96,039,638 (GRCm39) Y18* probably null Het
Tgm7 C A 2: 120,929,069 (GRCm39) probably null Het
Tjap1 A G 17: 46,569,718 (GRCm39) V424A probably benign Het
Trpm6 A T 19: 18,773,864 (GRCm39) I414F probably damaging Het
Tsr3 C G 17: 25,460,723 (GRCm39) D196E probably benign Het
Ubqlnl C T 7: 103,798,925 (GRCm39) V191M probably benign Het
Vmn2r72 T A 7: 85,401,134 (GRCm39) H95L probably benign Het
Vmn2r97 T A 17: 19,149,333 (GRCm39) N240K probably benign Het
Xdh C A 17: 74,205,339 (GRCm39) G1042V probably damaging Het
Zcchc4 A G 5: 52,941,409 (GRCm39) D68G probably damaging Het
Other mutations in Sipa1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Sipa1l2 APN 8 126,218,545 (GRCm39) missense probably damaging 1.00
IGL00939:Sipa1l2 APN 8 126,191,174 (GRCm39) splice site probably benign
IGL00965:Sipa1l2 APN 8 126,174,613 (GRCm39) missense probably benign 0.02
IGL01321:Sipa1l2 APN 8 126,218,257 (GRCm39) missense probably damaging 1.00
IGL01450:Sipa1l2 APN 8 126,149,316 (GRCm39) critical splice donor site probably null
IGL01753:Sipa1l2 APN 8 126,180,031 (GRCm39) splice site probably benign
IGL01930:Sipa1l2 APN 8 126,145,978 (GRCm39) missense probably damaging 0.99
IGL02041:Sipa1l2 APN 8 126,218,558 (GRCm39) missense probably benign 0.03
IGL02215:Sipa1l2 APN 8 126,174,576 (GRCm39) missense possibly damaging 0.67
IGL02272:Sipa1l2 APN 8 126,218,750 (GRCm39) missense probably damaging 1.00
IGL02370:Sipa1l2 APN 8 126,207,008 (GRCm39) missense probably damaging 1.00
IGL02538:Sipa1l2 APN 8 126,178,716 (GRCm39) missense probably damaging 1.00
IGL02633:Sipa1l2 APN 8 126,174,507 (GRCm39) missense probably damaging 1.00
IGL03394:Sipa1l2 APN 8 126,218,398 (GRCm39) missense possibly damaging 0.67
Rebellious UTSW 8 126,195,078 (GRCm39) missense probably benign 0.01
R0144:Sipa1l2 UTSW 8 126,176,615 (GRCm39) splice site probably null
R0153:Sipa1l2 UTSW 8 126,148,637 (GRCm39) missense probably damaging 0.99
R0276:Sipa1l2 UTSW 8 126,148,679 (GRCm39) missense probably damaging 1.00
R0318:Sipa1l2 UTSW 8 126,174,436 (GRCm39) missense possibly damaging 0.73
R0373:Sipa1l2 UTSW 8 126,191,149 (GRCm39) missense probably damaging 0.99
R0427:Sipa1l2 UTSW 8 126,207,071 (GRCm39) missense probably damaging 1.00
R0634:Sipa1l2 UTSW 8 126,149,363 (GRCm39) nonsense probably null
R1377:Sipa1l2 UTSW 8 126,218,716 (GRCm39) missense probably damaging 1.00
R1404:Sipa1l2 UTSW 8 126,176,712 (GRCm39) missense probably damaging 1.00
R1404:Sipa1l2 UTSW 8 126,176,712 (GRCm39) missense probably damaging 1.00
R1435:Sipa1l2 UTSW 8 126,195,464 (GRCm39) missense probably damaging 1.00
R1523:Sipa1l2 UTSW 8 126,174,352 (GRCm39) missense possibly damaging 0.75
R1577:Sipa1l2 UTSW 8 126,219,001 (GRCm39) missense probably benign 0.00
R1581:Sipa1l2 UTSW 8 126,218,356 (GRCm39) missense probably damaging 0.96
R1583:Sipa1l2 UTSW 8 126,148,634 (GRCm39) missense probably damaging 0.97
R1719:Sipa1l2 UTSW 8 126,171,274 (GRCm39) missense probably damaging 0.99
R1730:Sipa1l2 UTSW 8 126,206,880 (GRCm39) splice site probably null
R1940:Sipa1l2 UTSW 8 126,206,887 (GRCm39) splice site probably benign
R2007:Sipa1l2 UTSW 8 126,166,176 (GRCm39) missense probably damaging 1.00
R2141:Sipa1l2 UTSW 8 126,218,230 (GRCm39) missense probably benign 0.07
R2203:Sipa1l2 UTSW 8 126,218,366 (GRCm39) missense probably damaging 0.99
R2764:Sipa1l2 UTSW 8 126,219,113 (GRCm39) missense probably damaging 0.99
R3722:Sipa1l2 UTSW 8 126,200,323 (GRCm39) missense probably damaging 1.00
R3787:Sipa1l2 UTSW 8 126,177,122 (GRCm39) missense possibly damaging 0.52
R3787:Sipa1l2 UTSW 8 126,149,944 (GRCm39) missense probably benign
R4106:Sipa1l2 UTSW 8 126,219,047 (GRCm39) missense probably damaging 1.00
R4117:Sipa1l2 UTSW 8 126,195,249 (GRCm39) missense probably damaging 1.00
R4194:Sipa1l2 UTSW 8 126,218,411 (GRCm39) missense probably benign 0.00
R4237:Sipa1l2 UTSW 8 126,218,395 (GRCm39) missense probably benign 0.44
R4240:Sipa1l2 UTSW 8 126,218,395 (GRCm39) missense probably benign 0.44
R4448:Sipa1l2 UTSW 8 126,219,094 (GRCm39) missense probably damaging 1.00
R4515:Sipa1l2 UTSW 8 126,218,965 (GRCm39) missense probably benign 0.00
R4519:Sipa1l2 UTSW 8 126,218,965 (GRCm39) missense probably benign 0.00
R4557:Sipa1l2 UTSW 8 126,191,154 (GRCm39) missense probably damaging 0.98
R4667:Sipa1l2 UTSW 8 126,180,209 (GRCm39) missense possibly damaging 0.93
R4687:Sipa1l2 UTSW 8 126,217,984 (GRCm39) missense probably damaging 1.00
R4854:Sipa1l2 UTSW 8 126,200,340 (GRCm39) missense probably damaging 1.00
R4890:Sipa1l2 UTSW 8 126,218,606 (GRCm39) missense probably damaging 1.00
R5065:Sipa1l2 UTSW 8 126,218,324 (GRCm39) missense probably benign 0.19
R5194:Sipa1l2 UTSW 8 126,166,012 (GRCm39) missense possibly damaging 0.48
R5266:Sipa1l2 UTSW 8 126,218,865 (GRCm39) missense probably damaging 0.99
R5475:Sipa1l2 UTSW 8 126,218,334 (GRCm39) missense probably damaging 1.00
R5718:Sipa1l2 UTSW 8 126,217,987 (GRCm39) missense probably damaging 1.00
R5910:Sipa1l2 UTSW 8 126,218,423 (GRCm39) missense probably benign 0.42
R5916:Sipa1l2 UTSW 8 126,195,312 (GRCm39) missense probably damaging 1.00
R5941:Sipa1l2 UTSW 8 126,200,275 (GRCm39) missense probably damaging 0.99
R6083:Sipa1l2 UTSW 8 126,195,212 (GRCm39) missense possibly damaging 0.87
R6185:Sipa1l2 UTSW 8 126,194,992 (GRCm39) nonsense probably null
R6235:Sipa1l2 UTSW 8 126,201,610 (GRCm39) missense probably damaging 1.00
R6274:Sipa1l2 UTSW 8 126,196,611 (GRCm39) missense probably damaging 1.00
R6299:Sipa1l2 UTSW 8 126,180,203 (GRCm39) missense possibly damaging 0.75
R6374:Sipa1l2 UTSW 8 126,171,369 (GRCm39) missense probably damaging 1.00
R6459:Sipa1l2 UTSW 8 126,171,223 (GRCm39) critical splice donor site probably null
R6462:Sipa1l2 UTSW 8 126,217,969 (GRCm39) missense probably damaging 1.00
R6496:Sipa1l2 UTSW 8 126,176,633 (GRCm39) missense probably benign 0.00
R6543:Sipa1l2 UTSW 8 126,177,101 (GRCm39) missense possibly damaging 0.50
R7154:Sipa1l2 UTSW 8 126,195,078 (GRCm39) missense probably benign 0.01
R7192:Sipa1l2 UTSW 8 126,149,348 (GRCm39) missense probably benign 0.09
R7240:Sipa1l2 UTSW 8 126,196,599 (GRCm39) missense probably damaging 1.00
R7361:Sipa1l2 UTSW 8 126,180,071 (GRCm39) missense probably damaging 1.00
R7383:Sipa1l2 UTSW 8 126,174,385 (GRCm39) missense probably damaging 1.00
R7417:Sipa1l2 UTSW 8 126,208,845 (GRCm39) missense possibly damaging 0.93
R7604:Sipa1l2 UTSW 8 126,146,011 (GRCm39) missense probably benign 0.45
R7658:Sipa1l2 UTSW 8 126,219,029 (GRCm39) missense probably benign 0.00
R7743:Sipa1l2 UTSW 8 126,190,972 (GRCm39) missense probably damaging 1.00
R7781:Sipa1l2 UTSW 8 126,218,566 (GRCm39) missense possibly damaging 0.46
R7812:Sipa1l2 UTSW 8 126,218,334 (GRCm39) missense probably damaging 1.00
R7829:Sipa1l2 UTSW 8 126,178,727 (GRCm39) missense probably damaging 1.00
R7880:Sipa1l2 UTSW 8 126,191,132 (GRCm39) missense probably damaging 1.00
R7884:Sipa1l2 UTSW 8 126,174,337 (GRCm39) missense probably benign
R8057:Sipa1l2 UTSW 8 126,195,269 (GRCm39) missense probably damaging 1.00
R8082:Sipa1l2 UTSW 8 126,218,548 (GRCm39) missense possibly damaging 0.82
R8092:Sipa1l2 UTSW 8 126,145,907 (GRCm39) missense probably benign 0.03
R8247:Sipa1l2 UTSW 8 126,149,372 (GRCm39) missense probably benign 0.29
R8252:Sipa1l2 UTSW 8 126,195,410 (GRCm39) missense probably damaging 1.00
R8386:Sipa1l2 UTSW 8 126,218,832 (GRCm39) missense probably damaging 1.00
R8466:Sipa1l2 UTSW 8 126,218,985 (GRCm39) missense probably damaging 1.00
R8697:Sipa1l2 UTSW 8 126,208,855 (GRCm39) missense probably damaging 1.00
R8725:Sipa1l2 UTSW 8 126,177,125 (GRCm39) missense probably benign 0.28
R8727:Sipa1l2 UTSW 8 126,177,125 (GRCm39) missense probably benign 0.28
R9048:Sipa1l2 UTSW 8 126,174,465 (GRCm39) missense possibly damaging 0.59
R9224:Sipa1l2 UTSW 8 126,218,716 (GRCm39) missense probably damaging 1.00
R9279:Sipa1l2 UTSW 8 126,208,896 (GRCm39) missense probably damaging 1.00
R9392:Sipa1l2 UTSW 8 126,194,960 (GRCm39) missense probably benign
R9574:Sipa1l2 UTSW 8 126,169,453 (GRCm39) missense probably benign
R9591:Sipa1l2 UTSW 8 126,219,112 (GRCm39) missense probably damaging 0.99
R9614:Sipa1l2 UTSW 8 126,196,565 (GRCm39) missense probably null 0.01
R9690:Sipa1l2 UTSW 8 126,218,996 (GRCm39) missense probably benign
X0027:Sipa1l2 UTSW 8 126,218,875 (GRCm39) missense probably damaging 1.00
Z1177:Sipa1l2 UTSW 8 126,174,295 (GRCm39) missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TCTACAAAGTCCAGGTCCAGC -3'
(R):5'- ATGAGTGATCCAAGGCCGTC -3'

Sequencing Primer
(F):5'- AAAGTCCAGGTCCAGCTGCTC -3'
(R):5'- TGATCCAAGGCCGTCACAGG -3'
Posted On 2015-08-18