Incidental Mutation 'R4523:Olfr843'
ID334314
Institutional Source Beutler Lab
Gene Symbol Olfr843
Ensembl Gene ENSMUSG00000048391
Gene Nameolfactory receptor 843
SynonymsGA_x6K02T2PVTD-12986331-12985390, MOR155-2
MMRRC Submission 042004-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R4523 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location19242956-19251987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19249229 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 57 (T57A)
Ref Sequence ENSEMBL: ENSMUSP00000151203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061365] [ENSMUST00000214019] [ENSMUST00000214267]
Predicted Effect probably damaging
Transcript: ENSMUST00000061365
AA Change: T57A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000051027
Gene: ENSMUSG00000048391
AA Change: T57A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.4e-51 PFAM
Pfam:7tm_1 41 290 3.3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214019
AA Change: T57A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000214267
AA Change: T57A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.1329 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8a1 G T 5: 67,667,600 T796K probably benign Het
Atr T C 9: 95,862,863 S78P probably damaging Het
BC017643 A G 11: 121,224,108 probably benign Het
Calb2 C T 8: 110,148,509 probably null Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cdca7 A G 2: 72,479,698 S77G probably damaging Het
Cnot2 C T 10: 116,581,474 probably benign Het
Cstf2t T A 19: 31,083,082 V6D possibly damaging Het
Dido1 T C 2: 180,672,292 I852V probably damaging Het
Dmgdh C T 13: 93,688,630 Q154* probably null Het
Dnah12 T C 14: 26,770,022 F1138S probably damaging Het
Dnah12 G A 14: 26,876,958 A998T possibly damaging Het
Dusp5 T G 19: 53,537,601 Y225D probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam126a T C 5: 23,965,122 T410A probably benign Het
Fam193a G A 5: 34,443,371 D601N probably benign Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Fmo2 T C 1: 162,887,708 K115R probably benign Het
Gak G T 5: 108,576,566 Q1093K probably benign Het
Gm5277 G T 3: 78,892,186 noncoding transcript Het
Gm7173 A T X: 79,509,995 N291K possibly damaging Het
Hgsnat A G 8: 25,968,361 probably null Het
Map3k3 G A 11: 106,148,868 R278H probably damaging Het
Mrvi1 T C 7: 110,923,841 M338V probably benign Het
Muc4 T C 16: 32,736,336 probably benign Het
Nectin3 C A 16: 46,448,590 R483L probably benign Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Ntng1 A G 3: 109,934,996 S154P probably damaging Het
Olfml2b T C 1: 170,669,222 I474T probably benign Het
Olfr1054 C G 2: 86,333,300 D19H probably benign Het
Optc G T 1: 133,903,754 T138K possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pard3 C T 8: 127,398,627 P421S probably benign Het
Pcdhb22 G T 18: 37,520,421 E647D probably benign Het
Pclo A G 5: 14,679,992 probably benign Het
Prkce G T 17: 86,490,750 probably null Het
Prr12 T C 7: 45,048,523 D656G unknown Het
Ptprk A T 10: 28,466,052 D485V probably damaging Het
Ptprn2 T C 12: 116,876,000 L381P probably damaging Het
Rnf144b T C 13: 47,207,537 I51T probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Sh3glb2 A T 2: 30,350,699 V118E probably damaging Het
Sipa1l2 C T 8: 125,492,424 G58D probably damaging Het
Slc5a4a C T 10: 76,148,362 A46V probably damaging Het
Tepp T A 8: 95,313,010 Y18* probably null Het
Tgm7 C A 2: 121,098,588 probably null Het
Tjap1 A G 17: 46,258,792 V424A probably benign Het
Trpm6 A T 19: 18,796,500 I414F probably damaging Het
Tsr3 C G 17: 25,241,749 D196E probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Vmn2r97 T A 17: 18,929,071 N240K probably benign Het
Xdh C A 17: 73,898,344 G1042V probably damaging Het
Zcchc4 A G 5: 52,784,067 D68G probably damaging Het
Other mutations in Olfr843
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02104:Olfr843 APN 9 19248870 missense probably benign 0.21
IGL02338:Olfr843 APN 9 19248664 missense probably damaging 0.98
IGL03197:Olfr843 APN 9 19248802 missense probably benign 0.37
IGL03227:Olfr843 APN 9 19249222 missense probably damaging 1.00
IGL03046:Olfr843 UTSW 9 19249145 missense probably damaging 0.99
IGL03052:Olfr843 UTSW 9 19248642 nonsense probably null
R0423:Olfr843 UTSW 9 19248952 nonsense probably null
R1316:Olfr843 UTSW 9 19248739 missense probably benign 0.06
R1759:Olfr843 UTSW 9 19249088 missense probably benign 0.36
R1782:Olfr843 UTSW 9 19248581 missense probably benign 0.04
R2517:Olfr843 UTSW 9 19249061 missense probably benign 0.21
R3196:Olfr843 UTSW 9 19249199 missense probably damaging 1.00
R3742:Olfr843 UTSW 9 19248683 missense possibly damaging 0.91
R4191:Olfr843 UTSW 9 19249087 missense probably benign 0.05
R4320:Olfr843 UTSW 9 19248756 missense probably damaging 1.00
R4756:Olfr843 UTSW 9 19248857 missense possibly damaging 0.56
R4908:Olfr843 UTSW 9 19248853 missense probably benign 0.00
R5319:Olfr843 UTSW 9 19249033 missense possibly damaging 0.60
R5554:Olfr843 UTSW 9 19248743 missense probably benign 0.02
R6011:Olfr843 UTSW 9 19248511 missense probably damaging 0.98
R7330:Olfr843 UTSW 9 19249271 missense probably benign 0.01
R7862:Olfr843 UTSW 9 19249440 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CAGCAAGTAGACAACTTTCTAAGC -3'
(R):5'- ATGTGACCCCAAAGAATTTGTG -3'

Sequencing Primer
(F):5'- GACAACTTTCTAAGCCACCAAAAATC -3'
(R):5'- GTGACCCCAAAGAATTTGTGAAAAC -3'
Posted On2015-08-18