Incidental Mutation 'R4523:Atr'
ID334315
Institutional Source Beutler Lab
Gene Symbol Atr
Ensembl Gene ENSMUSG00000032409
Gene Nameataxia telangiectasia and Rad3 related
Synonyms
MMRRC Submission 042004-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4523 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location95857597-95951781 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95862863 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 78 (S78P)
Ref Sequence ENSEMBL: ENSMUSP00000149953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034980] [ENSMUST00000215311]
Predicted Effect probably damaging
Transcript: ENSMUST00000034980
AA Change: S78P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034980
Gene: ENSMUSG00000032409
AA Change: S78P

DomainStartEndE-ValueType
low complexity region 431 449 N/A INTRINSIC
low complexity region 889 897 N/A INTRINSIC
low complexity region 998 1013 N/A INTRINSIC
UME 1119 1225 2.3e-43 SMART
low complexity region 1352 1362 N/A INTRINSIC
Pfam:FAT 1771 2092 9.2e-51 PFAM
PI3Kc 2320 2630 7.51e-124 SMART
FATC 2609 2641 6.22e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178038
SMART Domains Protein: ENSMUSP00000136667
Gene: ENSMUSG00000096655

DomainStartEndE-ValueType
low complexity region 42 64 N/A INTRINSIC
low complexity region 109 122 N/A INTRINSIC
low complexity region 146 158 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188975
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191269
Predicted Effect probably damaging
Transcript: ENSMUST00000215311
AA Change: S78P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1560 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs the PI3/PI4-kinase family, and is most closely related to ATM, a protein kinase encoded by the gene mutated in ataxia telangiectasia. This protein and ATM share similarity with Schizosaccharomyces pombe rad3, a cell cycle checkpoint gene required for cell cycle arrest and DNA damage repair in response to DNA damage. This kinase has been shown to phosphorylate checkpoint kinase CHK1, checkpoint proteins RAD17, and RAD9, as well as tumor suppressor protein BRCA1. Mutations of this gene are associated with Seckel syndrome. An alternatively spliced transcript variant of this gene has been reported, however, its full length nature is not known. Transcript variants utilizing alternative polyA sites exist. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice heterozygous for a knock-out allele exhibit premature death and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8a1 G T 5: 67,667,600 T796K probably benign Het
BC017643 A G 11: 121,224,108 probably benign Het
Calb2 C T 8: 110,148,509 probably null Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cdca7 A G 2: 72,479,698 S77G probably damaging Het
Cnot2 C T 10: 116,581,474 probably benign Het
Cstf2t T A 19: 31,083,082 V6D possibly damaging Het
Dido1 T C 2: 180,672,292 I852V probably damaging Het
Dmgdh C T 13: 93,688,630 Q154* probably null Het
Dnah12 T C 14: 26,770,022 F1138S probably damaging Het
Dnah12 G A 14: 26,876,958 A998T possibly damaging Het
Dusp5 T G 19: 53,537,601 Y225D probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam126a T C 5: 23,965,122 T410A probably benign Het
Fam193a G A 5: 34,443,371 D601N probably benign Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Fmo2 T C 1: 162,887,708 K115R probably benign Het
Gak G T 5: 108,576,566 Q1093K probably benign Het
Gm5277 G T 3: 78,892,186 noncoding transcript Het
Gm7173 A T X: 79,509,995 N291K possibly damaging Het
Hgsnat A G 8: 25,968,361 probably null Het
Map3k3 G A 11: 106,148,868 R278H probably damaging Het
Mrvi1 T C 7: 110,923,841 M338V probably benign Het
Muc4 T C 16: 32,736,336 probably benign Het
Nectin3 C A 16: 46,448,590 R483L probably benign Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Ntng1 A G 3: 109,934,996 S154P probably damaging Het
Olfml2b T C 1: 170,669,222 I474T probably benign Het
Olfr1054 C G 2: 86,333,300 D19H probably benign Het
Olfr843 T C 9: 19,249,229 T57A probably damaging Het
Optc G T 1: 133,903,754 T138K possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pard3 C T 8: 127,398,627 P421S probably benign Het
Pcdhb22 G T 18: 37,520,421 E647D probably benign Het
Pclo A G 5: 14,679,992 probably benign Het
Prkce G T 17: 86,490,750 probably null Het
Prr12 T C 7: 45,048,523 D656G unknown Het
Ptprk A T 10: 28,466,052 D485V probably damaging Het
Ptprn2 T C 12: 116,876,000 L381P probably damaging Het
Rnf144b T C 13: 47,207,537 I51T probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Sh3glb2 A T 2: 30,350,699 V118E probably damaging Het
Sipa1l2 C T 8: 125,492,424 G58D probably damaging Het
Slc5a4a C T 10: 76,148,362 A46V probably damaging Het
Tepp T A 8: 95,313,010 Y18* probably null Het
Tgm7 C A 2: 121,098,588 probably null Het
Tjap1 A G 17: 46,258,792 V424A probably benign Het
Trpm6 A T 19: 18,796,500 I414F probably damaging Het
Tsr3 C G 17: 25,241,749 D196E probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Vmn2r97 T A 17: 18,929,071 N240K probably benign Het
Xdh C A 17: 73,898,344 G1042V probably damaging Het
Zcchc4 A G 5: 52,784,067 D68G probably damaging Het
Other mutations in Atr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Atr APN 9 95865052 missense probably damaging 1.00
IGL00922:Atr APN 9 95907345 missense probably damaging 0.97
IGL01020:Atr APN 9 95862783 missense probably damaging 1.00
IGL01345:Atr APN 9 95940949 missense probably damaging 1.00
IGL01364:Atr APN 9 95865624 missense probably benign 0.29
IGL01456:Atr APN 9 95950565 missense possibly damaging 0.62
IGL01534:Atr APN 9 95865546 missense probably damaging 0.99
IGL01761:Atr APN 9 95951448 splice site probably benign
IGL01791:Atr APN 9 95921781 missense probably benign 0.05
IGL01831:Atr APN 9 95870754 missense probably benign 0.18
IGL01973:Atr APN 9 95871674 missense probably damaging 1.00
IGL02008:Atr APN 9 95881420 splice site probably benign
IGL02016:Atr APN 9 95927175 missense probably benign 0.09
IGL02035:Atr APN 9 95866682 missense probably benign 0.01
IGL02058:Atr APN 9 95871487 missense probably damaging 0.99
IGL02081:Atr APN 9 95883205 missense probably damaging 1.00
IGL02224:Atr APN 9 95878629 missense probably damaging 0.98
IGL02234:Atr APN 9 95947250 splice site probably benign
IGL02367:Atr APN 9 95899141 nonsense probably null
IGL02621:Atr APN 9 95908400 missense probably benign 0.00
IGL02728:Atr APN 9 95936475 missense probably damaging 1.00
IGL02833:Atr APN 9 95862852 missense probably damaging 1.00
IGL02939:Atr APN 9 95865261 missense probably benign
IGL03107:Atr APN 9 95897730 missense probably benign 0.28
IGL03382:Atr APN 9 95920822 nonsense probably null
PIT4812001:Atr UTSW 9 95910649 missense probably benign 0.41
R0042:Atr UTSW 9 95927356 splice site probably benign
R0042:Atr UTSW 9 95927356 splice site probably benign
R0281:Atr UTSW 9 95937566 missense probably benign 0.26
R0282:Atr UTSW 9 95862798 missense probably benign 0.12
R0512:Atr UTSW 9 95935526 missense probably damaging 0.99
R0547:Atr UTSW 9 95899165 splice site probably benign
R0567:Atr UTSW 9 95865829 missense probably benign 0.00
R0631:Atr UTSW 9 95874777 missense possibly damaging 0.92
R1116:Atr UTSW 9 95867636 nonsense probably null
R1171:Atr UTSW 9 95907323 missense probably damaging 1.00
R1241:Atr UTSW 9 95950636 missense probably benign 0.08
R1345:Atr UTSW 9 95920355 missense probably benign 0.25
R1400:Atr UTSW 9 95862848 missense probably benign 0.32
R1413:Atr UTSW 9 95932442 missense probably damaging 1.00
R1527:Atr UTSW 9 95870043 missense possibly damaging 0.82
R1557:Atr UTSW 9 95871449 missense probably damaging 1.00
R1591:Atr UTSW 9 95945385 missense probably damaging 1.00
R1602:Atr UTSW 9 95951557 missense probably damaging 1.00
R1605:Atr UTSW 9 95936463 missense probably damaging 1.00
R1670:Atr UTSW 9 95861456 missense probably benign 0.38
R1709:Atr UTSW 9 95871076 missense probably benign 0.00
R1728:Atr UTSW 9 95897581 missense probably benign 0.01
R1729:Atr UTSW 9 95897581 missense probably benign 0.01
R1739:Atr UTSW 9 95897581 missense probably benign 0.01
R1816:Atr UTSW 9 95866694 missense probably benign 0.00
R1824:Atr UTSW 9 95936421 missense probably damaging 1.00
R1844:Atr UTSW 9 95905817 missense probably benign 0.01
R1857:Atr UTSW 9 95865097 missense probably damaging 1.00
R1858:Atr UTSW 9 95865097 missense probably damaging 1.00
R1866:Atr UTSW 9 95870605 splice site probably null
R1913:Atr UTSW 9 95866733 missense probably benign 0.01
R2042:Atr UTSW 9 95870022 missense probably benign 0.00
R2210:Atr UTSW 9 95907300 missense probably damaging 1.00
R2230:Atr UTSW 9 95920765 missense probably damaging 1.00
R2361:Atr UTSW 9 95871157 missense probably benign 0.41
R2399:Atr UTSW 9 95871599 missense probably benign 0.00
R2431:Atr UTSW 9 95862892 missense probably benign 0.24
R2860:Atr UTSW 9 95874243 missense probably benign 0.07
R2861:Atr UTSW 9 95874243 missense probably benign 0.07
R3019:Atr UTSW 9 95905818 missense possibly damaging 0.52
R3684:Atr UTSW 9 95920400 missense probably damaging 0.96
R4155:Atr UTSW 9 95888124 nonsense probably null
R4295:Atr UTSW 9 95874426 missense probably benign 0.04
R4359:Atr UTSW 9 95951536 missense probably damaging 1.00
R4506:Atr UTSW 9 95865237 missense probably benign 0.21
R4536:Atr UTSW 9 95874418 missense probably benign 0.26
R4588:Atr UTSW 9 95865667 missense probably benign
R4646:Atr UTSW 9 95871197 critical splice donor site probably null
R4702:Atr UTSW 9 95920355 missense possibly damaging 0.92
R4743:Atr UTSW 9 95862792 missense probably benign 0.14
R4782:Atr UTSW 9 95862797 missense probably benign 0.00
R4928:Atr UTSW 9 95907299 missense probably damaging 1.00
R5031:Atr UTSW 9 95865702 missense probably damaging 0.98
R5138:Atr UTSW 9 95937596 missense probably benign 0.15
R5188:Atr UTSW 9 95921725 missense probably benign 0.00
R5219:Atr UTSW 9 95881238 missense probably damaging 0.99
R5307:Atr UTSW 9 95878544 missense probably benign 0.01
R5414:Atr UTSW 9 95870704 missense probably benign 0.00
R5628:Atr UTSW 9 95874226 nonsense probably null
R5664:Atr UTSW 9 95905813 missense probably benign 0.00
R5678:Atr UTSW 9 95951487 nonsense probably null
R5724:Atr UTSW 9 95866588 missense probably damaging 1.00
R5759:Atr UTSW 9 95874402 missense probably benign 0.01
R5763:Atr UTSW 9 95945123 missense probably benign 0.04
R5922:Atr UTSW 9 95903682 missense probably benign 0.00
R6051:Atr UTSW 9 95908369 missense possibly damaging 0.85
R6161:Atr UTSW 9 95865319 missense probably benign
R6171:Atr UTSW 9 95881271 nonsense probably null
R6532:Atr UTSW 9 95908408 missense probably benign
R6774:Atr UTSW 9 95927213 missense probably benign 0.00
R6894:Atr UTSW 9 95927197 missense probably damaging 1.00
R6930:Atr UTSW 9 95866635 missense probably benign 0.21
R7018:Atr UTSW 9 95866694 missense probably benign 0.17
R7056:Atr UTSW 9 95862863 missense probably damaging 1.00
R7103:Atr UTSW 9 95865372 missense probably damaging 0.98
R7154:Atr UTSW 9 95865045 missense probably benign
R7157:Atr UTSW 9 95869900 missense probably benign 0.00
R7188:Atr UTSW 9 95862791 nonsense probably null
R7189:Atr UTSW 9 95862791 nonsense probably null
R7300:Atr UTSW 9 95865370 missense probably benign 0.00
R7337:Atr UTSW 9 95871448 missense probably damaging 1.00
R7584:Atr UTSW 9 95942713 missense probably damaging 1.00
R7602:Atr UTSW 9 95907383 missense possibly damaging 0.64
R7633:Atr UTSW 9 95947118 missense probably damaging 1.00
R7640:Atr UTSW 9 95907293 splice site probably null
R7677:Atr UTSW 9 95885462 missense probably damaging 1.00
R7699:Atr UTSW 9 95875690 nonsense probably null
R7700:Atr UTSW 9 95875690 nonsense probably null
R7790:Atr UTSW 9 95874180 missense probably damaging 1.00
R8027:Atr UTSW 9 95865756 missense probably damaging 0.99
R8147:Atr UTSW 9 95899060 missense probably damaging 1.00
R8204:Atr UTSW 9 95935513 missense
R8306:Atr UTSW 9 95920370 missense
X0019:Atr UTSW 9 95940871 missense probably damaging 1.00
Z1088:Atr UTSW 9 95885320 splice site probably null
Z1177:Atr UTSW 9 95888100 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGATCTGTGGAGCTTCCTGG -3'
(R):5'- GCAAATATGACTTGTGGGAGCATG -3'

Sequencing Primer
(F):5'- CAGTGTAGCATGAGTACTCCACTG -3'
(R):5'- GCACTTACCAATACAACTGTC -3'
Posted On2015-08-18