Incidental Mutation 'R4523:BC017643'
ID334320
Institutional Source Beutler Lab
Gene Symbol BC017643
Ensembl Gene ENSMUSG00000039294
Gene NamecDNA sequence BC017643
Synonyms
MMRRC Submission 042004-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4523 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location121222588-121229322 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 121224108 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038709] [ENSMUST00000038831] [ENSMUST00000106115] [ENSMUST00000106117] [ENSMUST00000137299] [ENSMUST00000147490] [ENSMUST00000169393]
Predicted Effect probably benign
Transcript: ENSMUST00000038709
SMART Domains Protein: ENSMUSP00000042277
Gene: ENSMUSG00000039294

DomainStartEndE-ValueType
Pfam:DUF4564 1 187 1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038831
SMART Domains Protein: ENSMUSP00000048479
Gene: ENSMUSG00000039307

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 30 223 2.9e-12 PFAM
low complexity region 528 538 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106115
SMART Domains Protein: ENSMUSP00000101721
Gene: ENSMUSG00000039294

DomainStartEndE-ValueType
Pfam:DUF4564 2 184 3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106117
SMART Domains Protein: ENSMUSP00000101723
Gene: ENSMUSG00000039307

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 31 229 1.7e-18 PFAM
low complexity region 455 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124761
SMART Domains Protein: ENSMUSP00000116406
Gene: ENSMUSG00000039307

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 20 194 6.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133535
Predicted Effect probably benign
Transcript: ENSMUST00000137299
SMART Domains Protein: ENSMUSP00000120541
Gene: ENSMUSG00000039294

DomainStartEndE-ValueType
Pfam:DUF4564 1 150 9.9e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147490
SMART Domains Protein: ENSMUSP00000117829
Gene: ENSMUSG00000039294

DomainStartEndE-ValueType
Pfam:DUF4564 1 132 7.2e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149351
Predicted Effect probably benign
Transcript: ENSMUST00000169393
SMART Domains Protein: ENSMUSP00000127260
Gene: ENSMUSG00000039294

DomainStartEndE-ValueType
Pfam:DUF4564 1 51 6.9e-20 PFAM
low complexity region 67 78 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156214
SMART Domains Protein: ENSMUSP00000131293
Gene: ENSMUSG00000039294

DomainStartEndE-ValueType
Pfam:DUF4564 1 57 1.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151495
SMART Domains Protein: ENSMUSP00000123073
Gene: ENSMUSG00000039307

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 27 220 3.1e-12 PFAM
low complexity region 525 535 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8a1 G T 5: 67,667,600 T796K probably benign Het
Atr T C 9: 95,862,863 S78P probably damaging Het
Calb2 C T 8: 110,148,509 probably null Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cdca7 A G 2: 72,479,698 S77G probably damaging Het
Cnot2 C T 10: 116,581,474 probably benign Het
Cstf2t T A 19: 31,083,082 V6D possibly damaging Het
Dido1 T C 2: 180,672,292 I852V probably damaging Het
Dmgdh C T 13: 93,688,630 Q154* probably null Het
Dnah12 T C 14: 26,770,022 F1138S probably damaging Het
Dnah12 G A 14: 26,876,958 A998T possibly damaging Het
Dusp5 T G 19: 53,537,601 Y225D probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam126a T C 5: 23,965,122 T410A probably benign Het
Fam193a G A 5: 34,443,371 D601N probably benign Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Fmo2 T C 1: 162,887,708 K115R probably benign Het
Gak G T 5: 108,576,566 Q1093K probably benign Het
Gm5277 G T 3: 78,892,186 noncoding transcript Het
Gm7173 A T X: 79,509,995 N291K possibly damaging Het
Hgsnat A G 8: 25,968,361 probably null Het
Map3k3 G A 11: 106,148,868 R278H probably damaging Het
Mrvi1 T C 7: 110,923,841 M338V probably benign Het
Muc4 T C 16: 32,736,336 probably benign Het
Nectin3 C A 16: 46,448,590 R483L probably benign Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Ntng1 A G 3: 109,934,996 S154P probably damaging Het
Olfml2b T C 1: 170,669,222 I474T probably benign Het
Olfr1054 C G 2: 86,333,300 D19H probably benign Het
Olfr843 T C 9: 19,249,229 T57A probably damaging Het
Optc G T 1: 133,903,754 T138K possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pard3 C T 8: 127,398,627 P421S probably benign Het
Pcdhb22 G T 18: 37,520,421 E647D probably benign Het
Pclo A G 5: 14,679,992 probably benign Het
Prkce G T 17: 86,490,750 probably null Het
Prr12 T C 7: 45,048,523 D656G unknown Het
Ptprk A T 10: 28,466,052 D485V probably damaging Het
Ptprn2 T C 12: 116,876,000 L381P probably damaging Het
Rnf144b T C 13: 47,207,537 I51T probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Sh3glb2 A T 2: 30,350,699 V118E probably damaging Het
Sipa1l2 C T 8: 125,492,424 G58D probably damaging Het
Slc5a4a C T 10: 76,148,362 A46V probably damaging Het
Tepp T A 8: 95,313,010 Y18* probably null Het
Tgm7 C A 2: 121,098,588 probably null Het
Tjap1 A G 17: 46,258,792 V424A probably benign Het
Trpm6 A T 19: 18,796,500 I414F probably damaging Het
Tsr3 C G 17: 25,241,749 D196E probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Vmn2r97 T A 17: 18,929,071 N240K probably benign Het
Xdh C A 17: 73,898,344 G1042V probably damaging Het
Zcchc4 A G 5: 52,784,067 D68G probably damaging Het
Other mutations in BC017643
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:BC017643 APN 11 121228330 missense probably damaging 1.00
IGL01476:BC017643 APN 11 121225845 missense probably damaging 1.00
R0737:BC017643 UTSW 11 121227242 critical splice donor site probably null
R4067:BC017643 UTSW 11 121224702 splice site probably null
R4162:BC017643 UTSW 11 121224666 missense probably damaging 0.99
R4524:BC017643 UTSW 11 121224108 unclassified probably benign
X0013:BC017643 UTSW 11 121228342 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACACCCTGCATCCTGATAGATG -3'
(R):5'- GTGGAACTGTACCCTTTGCC -3'

Sequencing Primer
(F):5'- ATCCTGATAGATGCAACCTTTCTGGG -3'
(R):5'- TTTGCCAAGGTGACCTGC -3'
Posted On2015-08-18