Mutagenetix > Incidental Mutations

Incidental Mutation 'R4523:Ptprn2'

334323

Institutional Source

Beutler Lab

Gene Symbol

Ptprn2

Ensembl Gene

ENSMUSG00000056553

Gene Name

protein tyrosine phosphatase, receptor type, N polypeptide 2

Synonyms

phogrin, 4930425H11Rik, IA-2 beta, PTP-NP, IA-2beta

MMRRC Submission

042004-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.294) question?

Stock #

R4523 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

116485720-117276849 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 116876000 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 381 (L381P)

Ref Sequence

ENSEMBL: ENSMUSP00000139978 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]

Predicted Effect

probably damaging
Transcript: ENSMUST00000070733
AA Change: L381P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: L381P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
RESP18	58	157	1.9e-40	SMART
low complexity region	393	426	N/A	INTRINSIC
Pfam:Receptor_IA-2	495	583	1.5e-35	PFAM
low complexity region	687	707	N/A	INTRINSIC
PTPc	730	993	4.42e-119	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189009

Predicted Effect

probably damaging
Transcript: ENSMUST00000190247
AA Change: L381P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553
AA Change: L381P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
RESP18	58	157	1.9e-40	SMART
low complexity region	393	426	N/A	INTRINSIC
Pfam:Receptor_IA-2	494	584	2.5e-43	PFAM
transmembrane domain	602	624	N/A	INTRINSIC
low complexity region	687	707	N/A	INTRINSIC
PTPc	730	932	8.81e-64	SMART

Meta Mutation Damage Score

0.3711

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp8a1	G	T	5: 67,667,600	T796K	probably benign	Het
Atr	T	C	9: 95,862,863	S78P	probably damaging	Het
BC017643	A	G	11: 121,224,108		probably benign	Het
Calb2	C	T	8: 110,148,509		probably null	Het
Ccdc88c	G	T	12: 100,913,332	S1843R	possibly damaging	Het
Cdca7	A	G	2: 72,479,698	S77G	probably damaging	Het
Cnot2	C	T	10: 116,581,474		probably benign	Het
Cstf2t	T	A	19: 31,083,082	V6D	possibly damaging	Het
Dido1	T	C	2: 180,672,292	I852V	probably damaging	Het
Dmgdh	C	T	13: 93,688,630	Q154*	probably null	Het
Dnah12	T	C	14: 26,770,022	F1138S	probably damaging	Het
Dnah12	G	A	14: 26,876,958	A998T	possibly damaging	Het
Dusp5	T	G	19: 53,537,601	Y225D	probably damaging	Het
Fam122c	G	A	X: 53,293,499	R94H	possibly damaging	Het
Fam126a	T	C	5: 23,965,122	T410A	probably benign	Het
Fam193a	G	A	5: 34,443,371	D601N	probably benign	Het
Fbxo41	A	G	6: 85,484,042	I228T	probably damaging	Het
Fmo2	T	C	1: 162,887,708	K115R	probably benign	Het
Gak	G	T	5: 108,576,566	Q1093K	probably benign	Het
Gm5277	G	T	3: 78,892,186		noncoding transcript	Het
Gm7173	A	T	X: 79,509,995	N291K	possibly damaging	Het
Hgsnat	A	G	8: 25,968,361		probably null	Het
Map3k3	G	A	11: 106,148,868	R278H	probably damaging	Het
Mrvi1	T	C	7: 110,923,841	M338V	probably benign	Het
Muc4	T	C	16: 32,736,336		probably benign	Het
Nectin3	C	A	16: 46,448,590	R483L	probably benign	Het
Nop2	G	T	6: 125,133,552	R47L	probably damaging	Het
Ntng1	A	G	3: 109,934,996	S154P	probably damaging	Het
Olfml2b	T	C	1: 170,669,222	I474T	probably benign	Het
Olfr1054	C	G	2: 86,333,300	D19H	probably benign	Het
Olfr843	T	C	9: 19,249,229	T57A	probably damaging	Het
Optc	G	T	1: 133,903,754	T138K	possibly damaging	Het
Orc4	G	A	2: 48,937,489	P31S	probably benign	Het
Pard3	C	T	8: 127,398,627	P421S	probably benign	Het
Pcdhb22	G	T	18: 37,520,421	E647D	probably benign	Het
Pclo	A	G	5: 14,679,992		probably benign	Het
Prkce	G	T	17: 86,490,750		probably null	Het
Prr12	T	C	7: 45,048,523	D656G	unknown	Het
Ptprk	A	T	10: 28,466,052	D485V	probably damaging	Het
Rnf144b	T	C	13: 47,207,537	I51T	probably benign	Het
Rpl10l	T	C	12: 66,283,738	D207G	probably benign	Het
Sh3glb2	A	T	2: 30,350,699	V118E	probably damaging	Het
Sipa1l2	C	T	8: 125,492,424	G58D	probably damaging	Het
Slc5a4a	C	T	10: 76,148,362	A46V	probably damaging	Het
Tepp	T	A	8: 95,313,010	Y18*	probably null	Het
Tgm7	C	A	2: 121,098,588		probably null	Het
Tjap1	A	G	17: 46,258,792	V424A	probably benign	Het
Trpm6	A	T	19: 18,796,500	I414F	probably damaging	Het
Tsr3	C	G	17: 25,241,749	D196E	probably benign	Het
Ubqlnl	C	T	7: 104,149,718	V191M	probably benign	Het
Vmn2r72	T	A	7: 85,751,926	H95L	probably benign	Het
Vmn2r97	T	A	17: 18,929,071	N240K	probably benign	Het
Xdh	C	A	17: 73,898,344	G1042V	probably damaging	Het
Zcchc4	A	G	5: 52,784,067	D68G	probably damaging	Het

Other mutations in Ptprn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01695:Ptprn2	APN	12	116841388	missense	probably benign	0.02
IGL01788:Ptprn2	APN	12	116900987	missense	probably damaging	0.98
IGL02172:Ptprn2	APN	12	116873697	splice site	probably benign
IGL02339:Ptprn2	APN	12	116722104	missense	probably damaging	1.00
IGL02706:Ptprn2	APN	12	116888898	missense	probably damaging	0.96
IGL03018:Ptprn2	APN	12	117211943	missense	probably damaging	1.00
IGL03267:Ptprn2	APN	12	116876344	nonsense	probably null
BB001:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
BB011:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
IGL03014:Ptprn2	UTSW	12	117248688	missense	probably damaging	1.00
R0066:Ptprn2	UTSW	12	117276602	missense	probably benign	0.07
R0066:Ptprn2	UTSW	12	117276602	missense	probably benign	0.07
R0115:Ptprn2	UTSW	12	117211846	splice site	probably benign
R0131:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0131:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0132:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0481:Ptprn2	UTSW	12	117211846	splice site	probably benign
R0694:Ptprn2	UTSW	12	116824355	missense	possibly damaging	0.69
R0698:Ptprn2	UTSW	12	116722130	nonsense	probably null
R0746:Ptprn2	UTSW	12	116901017	missense	probably benign	0.00
R1127:Ptprn2	UTSW	12	117212008	splice site	probably null
R1443:Ptprn2	UTSW	12	117253615	missense	probably damaging	1.00
R1508:Ptprn2	UTSW	12	117184722	missense	probably damaging	1.00
R1664:Ptprn2	UTSW	12	117161709	missense	probably damaging	0.99
R1670:Ptprn2	UTSW	12	116722172	missense	possibly damaging	0.64
R1749:Ptprn2	UTSW	12	116580428	missense	probably benign	0.00
R2075:Ptprn2	UTSW	12	117247717	missense	probably benign	0.01
R3054:Ptprn2	UTSW	12	116722133	missense	probably damaging	1.00
R3107:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R3109:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R3552:Ptprn2	UTSW	12	116888877	missense	probably benign	0.00
R4193:Ptprn2	UTSW	12	116901008	missense	probably benign	0.01
R4706:Ptprn2	UTSW	12	116872094	missense	probably benign	0.02
R4719:Ptprn2	UTSW	12	116824396	missense	possibly damaging	0.95
R4726:Ptprn2	UTSW	12	117247773	nonsense	probably null
R4872:Ptprn2	UTSW	12	117161694	missense	probably damaging	1.00
R4891:Ptprn2	UTSW	12	117233365	splice site	probably null
R4970:Ptprn2	UTSW	12	117276595	missense	probably damaging	1.00
R5208:Ptprn2	UTSW	12	116858928	missense	probably damaging	1.00
R5287:Ptprn2	UTSW	12	117211862	missense	probably damaging	1.00
R5419:Ptprn2	UTSW	12	117184647	missense	probably damaging	0.99
R6035:Ptprn2	UTSW	12	117255595	missense	probably damaging	1.00
R6035:Ptprn2	UTSW	12	117255595	missense	probably damaging	1.00
R6180:Ptprn2	UTSW	12	116859119	missense	probably benign	0.05
R6277:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R6465:Ptprn2	UTSW	12	117269589	missense	probably damaging	0.96
R6488:Ptprn2	UTSW	12	116872038	missense	probably benign	0.13
R6555:Ptprn2	UTSW	12	117227200	missense	probably damaging	1.00
R6908:Ptprn2	UTSW	12	116888888	missense	probably benign	0.06
R7120:Ptprn2	UTSW	12	116872056	missense	probably benign	0.01
R7229:Ptprn2	UTSW	12	117227225	splice site	probably null
R7237:Ptprn2	UTSW	12	117161727	missense	probably benign	0.03
R7304:Ptprn2	UTSW	12	117248544	missense	probably damaging	1.00
R7355:Ptprn2	UTSW	12	116858951	missense	probably benign
R7460:Ptprn2	UTSW	12	117248681	missense	probably benign	0.05
R7577:Ptprn2	UTSW	12	116485866	start codon destroyed	probably null
R7658:Ptprn2	UTSW	12	116722119	missense	probably benign	0.01
R7666:Ptprn2	UTSW	12	116841320	missense	probably benign	0.10
R7924:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
R8219:Ptprn2	UTSW	12	117184737	missense	probably benign	0.30
R8716:Ptprn2	UTSW	12	117255548	missense	possibly damaging	0.73
X0066:Ptprn2	UTSW	12	117161760	missense	probably damaging	1.00
X0066:Ptprn2	UTSW	12	117184740	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- TCTCCAGGAAGGTGTGTGAG -3'
(R):5'- TAAGTCCGGCTCCTCACATG -3'

Sequencing Primer
(F):5'- TGAAGTGACTCTGACACCCTG -3'
(R):5'- TGCTCCACCCCAGCAGTC -3'

Posted On

2015-08-18