Incidental Mutation 'R4523:Xdh'
ID 334334
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Name xanthine dehydrogenase
Synonyms xanthine oxidase, XO, Xor, Xox1, Xox-1
MMRRC Submission 042004-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.299) question?
Stock # R4523 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 73883908-73950182 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 73898344 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 1042 (G1042V)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
AlphaFold Q00519
Predicted Effect probably damaging
Transcript: ENSMUST00000024866
AA Change: G1042V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: G1042V

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Meta Mutation Damage Score 0.9595 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8a1 G T 5: 67,667,600 T796K probably benign Het
Atr T C 9: 95,862,863 S78P probably damaging Het
BC017643 A G 11: 121,224,108 probably benign Het
Calb2 C T 8: 110,148,509 probably null Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cdca7 A G 2: 72,479,698 S77G probably damaging Het
Cnot2 C T 10: 116,581,474 probably benign Het
Cstf2t T A 19: 31,083,082 V6D possibly damaging Het
Dido1 T C 2: 180,672,292 I852V probably damaging Het
Dmgdh C T 13: 93,688,630 Q154* probably null Het
Dnah12 T C 14: 26,770,022 F1138S probably damaging Het
Dnah12 G A 14: 26,876,958 A998T possibly damaging Het
Dusp5 T G 19: 53,537,601 Y225D probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam126a T C 5: 23,965,122 T410A probably benign Het
Fam193a G A 5: 34,443,371 D601N probably benign Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Fmo2 T C 1: 162,887,708 K115R probably benign Het
Gak G T 5: 108,576,566 Q1093K probably benign Het
Gm5277 G T 3: 78,892,186 noncoding transcript Het
Gm7173 A T X: 79,509,995 N291K possibly damaging Het
Hgsnat A G 8: 25,968,361 probably null Het
Map3k3 G A 11: 106,148,868 R278H probably damaging Het
Mrvi1 T C 7: 110,923,841 M338V probably benign Het
Muc4 T C 16: 32,736,336 probably benign Het
Nectin3 C A 16: 46,448,590 R483L probably benign Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Ntng1 A G 3: 109,934,996 S154P probably damaging Het
Olfml2b T C 1: 170,669,222 I474T probably benign Het
Olfr1054 C G 2: 86,333,300 D19H probably benign Het
Olfr843 T C 9: 19,249,229 T57A probably damaging Het
Optc G T 1: 133,903,754 T138K possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pard3 C T 8: 127,398,627 P421S probably benign Het
Pcdhb22 G T 18: 37,520,421 E647D probably benign Het
Pclo A G 5: 14,679,992 probably benign Het
Prkce G T 17: 86,490,750 probably null Het
Prr12 T C 7: 45,048,523 D656G unknown Het
Ptprk A T 10: 28,466,052 D485V probably damaging Het
Ptprn2 T C 12: 116,876,000 L381P probably damaging Het
Rnf144b T C 13: 47,207,537 I51T probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Sh3glb2 A T 2: 30,350,699 V118E probably damaging Het
Sipa1l2 C T 8: 125,492,424 G58D probably damaging Het
Slc5a4a C T 10: 76,148,362 A46V probably damaging Het
Tepp T A 8: 95,313,010 Y18* probably null Het
Tgm7 C A 2: 121,098,588 probably null Het
Tjap1 A G 17: 46,258,792 V424A probably benign Het
Trpm6 A T 19: 18,796,500 I414F probably damaging Het
Tsr3 C G 17: 25,241,749 D196E probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Vmn2r97 T A 17: 18,929,071 N240K probably benign Het
Zcchc4 A G 5: 52,784,067 D68G probably damaging Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 73923106 missense possibly damaging 0.58
IGL00556:Xdh APN 17 73884435 makesense probably null
IGL01524:Xdh APN 17 73923137 critical splice acceptor site probably null
IGL01604:Xdh APN 17 73909337 missense probably benign 0.02
IGL01625:Xdh APN 17 73916786 critical splice donor site probably null
IGL01778:Xdh APN 17 73900280 missense probably benign 0.00
IGL01804:Xdh APN 17 73892759 missense probably damaging 1.00
IGL01825:Xdh APN 17 73891245 missense probably damaging 1.00
IGL01929:Xdh APN 17 73934855 missense probably damaging 1.00
IGL02068:Xdh APN 17 73913950 missense probably damaging 1.00
IGL02079:Xdh APN 17 73891277 missense probably damaging 1.00
IGL02210:Xdh APN 17 73943895 missense probably benign 0.00
IGL02261:Xdh APN 17 73913965 missense possibly damaging 0.81
IGL02365:Xdh APN 17 73943890 missense probably benign 0.14
IGL02424:Xdh APN 17 73926570 missense probably benign 0.00
IGL02491:Xdh APN 17 73886464 missense probably damaging 0.99
IGL02525:Xdh APN 17 73924995 missense possibly damaging 0.91
IGL02578:Xdh APN 17 73906246 missense probably damaging 1.00
IGL02793:Xdh APN 17 73900581 missense probably damaging 1.00
IGL02939:Xdh APN 17 73943845 critical splice donor site probably null
IGL03327:Xdh APN 17 73916792 missense probably benign
IGL03345:Xdh APN 17 73906032 missense probably damaging 0.98
IGL03353:Xdh APN 17 73895786 missense possibly damaging 0.65
inky UTSW 17 73921351 missense probably damaging 1.00
nucleus UTSW 17 73899012 nonsense probably null
squidgame UTSW 17 73939836 missense probably benign
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0033:Xdh UTSW 17 73907632 missense probably benign 0.06
R0079:Xdh UTSW 17 73891218 missense probably damaging 1.00
R0086:Xdh UTSW 17 73884438 missense probably benign
R0319:Xdh UTSW 17 73906101 splice site probably benign
R0336:Xdh UTSW 17 73922463 missense possibly damaging 0.91
R0389:Xdh UTSW 17 73898362 missense probably damaging 1.00
R0684:Xdh UTSW 17 73943891 missense probably damaging 0.97
R0930:Xdh UTSW 17 73923082 missense probably benign 0.00
R1073:Xdh UTSW 17 73939836 missense probably benign
R1114:Xdh UTSW 17 73941149 splice site probably benign
R1201:Xdh UTSW 17 73918418 missense probably benign 0.05
R1230:Xdh UTSW 17 73891256 missense probably damaging 1.00
R1351:Xdh UTSW 17 73923078 missense probably benign 0.02
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1485:Xdh UTSW 17 73914019 nonsense probably null
R1548:Xdh UTSW 17 73913901 missense probably damaging 0.98
R1637:Xdh UTSW 17 73900578 missense probably benign
R1641:Xdh UTSW 17 73926552 missense probably benign
R1758:Xdh UTSW 17 73910209 missense probably damaging 1.00
R1951:Xdh UTSW 17 73907658 missense probably damaging 1.00
R1969:Xdh UTSW 17 73892751 missense possibly damaging 0.55
R2024:Xdh UTSW 17 73921305 missense possibly damaging 0.92
R2080:Xdh UTSW 17 73909325 missense probably damaging 1.00
R2157:Xdh UTSW 17 73922537 missense probably damaging 1.00
R2300:Xdh UTSW 17 73891265 missense probably damaging 1.00
R3783:Xdh UTSW 17 73893595 splice site probably benign
R3796:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3797:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3798:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3799:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3819:Xdh UTSW 17 73906725 missense probably benign 0.35
R4085:Xdh UTSW 17 73916879 missense probably benign 0.35
R4240:Xdh UTSW 17 73895795 missense possibly damaging 0.72
R4356:Xdh UTSW 17 73915690 missense probably benign 0.01
R4522:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4524:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4600:Xdh UTSW 17 73910200 missense probably benign 0.19
R4617:Xdh UTSW 17 73918394 missense probably damaging 0.99
R4756:Xdh UTSW 17 73886386 missense probably benign 0.24
R4761:Xdh UTSW 17 73910267 missense possibly damaging 0.91
R4815:Xdh UTSW 17 73906215 missense probably damaging 1.00
R4850:Xdh UTSW 17 73898335 missense probably damaging 1.00
R4896:Xdh UTSW 17 73910243 missense probably damaging 0.96
R4897:Xdh UTSW 17 73900708 missense probably benign
R4923:Xdh UTSW 17 73924936 missense possibly damaging 0.72
R4977:Xdh UTSW 17 73898970 missense probably benign 0.05
R5030:Xdh UTSW 17 73891293 missense probably damaging 1.00
R5185:Xdh UTSW 17 73925011 missense probably damaging 1.00
R5347:Xdh UTSW 17 73925032 missense probably benign
R5556:Xdh UTSW 17 73897764 missense probably benign 0.21
R5566:Xdh UTSW 17 73893622 missense probably damaging 1.00
R5568:Xdh UTSW 17 73943885 missense possibly damaging 0.90
R5635:Xdh UTSW 17 73913875 missense possibly damaging 0.92
R5662:Xdh UTSW 17 73941115 missense probably damaging 0.99
R5955:Xdh UTSW 17 73898320 missense probably damaging 1.00
R6058:Xdh UTSW 17 73906269 missense probably damaging 1.00
R6061:Xdh UTSW 17 73921347 missense probably damaging 1.00
R6412:Xdh UTSW 17 73935907 missense probably benign 0.09
R6526:Xdh UTSW 17 73900551 missense probably damaging 0.97
R6558:Xdh UTSW 17 73893713 missense possibly damaging 0.95
R6843:Xdh UTSW 17 73923130 missense probably damaging 1.00
R6932:Xdh UTSW 17 73922562 missense probably damaging 0.99
R7028:Xdh UTSW 17 73943873 missense probably damaging 0.99
R7418:Xdh UTSW 17 73913965 missense possibly damaging 0.81
R7503:Xdh UTSW 17 73926210 missense probably damaging 1.00
R7653:Xdh UTSW 17 73897045 missense probably benign 0.10
R7763:Xdh UTSW 17 73934834 missense possibly damaging 0.69
R7768:Xdh UTSW 17 73939836 missense probably benign
R7904:Xdh UTSW 17 73922472 missense probably benign 0.09
R8010:Xdh UTSW 17 73909317 nonsense probably null
R8067:Xdh UTSW 17 73900657 missense probably benign 0.01
R8238:Xdh UTSW 17 73886417 missense probably benign
R8253:Xdh UTSW 17 73918382 missense possibly damaging 0.94
R8346:Xdh UTSW 17 73913943 missense probably damaging 1.00
R8350:Xdh UTSW 17 73934842 missense probably damaging 1.00
R8381:Xdh UTSW 17 73912461 missense probably benign
R8427:Xdh UTSW 17 73935931 missense probably damaging 1.00
R8465:Xdh UTSW 17 73899012 nonsense probably null
R8478:Xdh UTSW 17 73906058 missense probably benign 0.00
R8680:Xdh UTSW 17 73922505 missense probably benign
R8802:Xdh UTSW 17 73918410 missense probably benign 0.00
R8984:Xdh UTSW 17 73921351 missense probably damaging 1.00
R8985:Xdh UTSW 17 73921351 missense probably damaging 1.00
R8995:Xdh UTSW 17 73898374 missense probably damaging 1.00
R9035:Xdh UTSW 17 73910227 missense probably benign
R9149:Xdh UTSW 17 73915693 missense probably benign
R9181:Xdh UTSW 17 73925011 missense probably damaging 1.00
R9357:Xdh UTSW 17 73907716 missense probably damaging 0.97
R9357:Xdh UTSW 17 73926546 critical splice donor site probably null
R9609:Xdh UTSW 17 73924995 missense possibly damaging 0.91
R9803:Xdh UTSW 17 73922460 missense probably benign
X0019:Xdh UTSW 17 73918454 missense probably damaging 1.00
Z1088:Xdh UTSW 17 73886428 missense probably benign
Z1176:Xdh UTSW 17 73923042 critical splice donor site probably null
Z1177:Xdh UTSW 17 73897695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGTAATGGACATACCCTGG -3'
(R):5'- ACACTGTTTAATTTTCGCTTGGGTC -3'

Sequencing Primer
(F):5'- CCTGGGGGATTATCTAGTCAGTAGC -3'
(R):5'- CAAATGTTGTGGTTGGCC -3'
Posted On 2015-08-18