Incidental Mutation 'R4523:Cstf2t'
ID334338
Institutional Source Beutler Lab
Gene Symbol Cstf2t
Ensembl Gene ENSMUSG00000053536
Gene Namecleavage stimulation factor, 3' pre-RNA subunit 2, tau
Synonyms64kDa, tCstF-64
MMRRC Submission 042004-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.494) question?
Stock #R4523 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location31082841-31086590 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31083082 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 6 (V6D)
Ref Sequence ENSEMBL: ENSMUSP00000093831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065067] [ENSMUST00000066039] [ENSMUST00000073581]
Predicted Effect probably benign
Transcript: ENSMUST00000065067
SMART Domains Protein: ENSMUSP00000067576
Gene: ENSMUSG00000052920

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
cNMP 103 216 6.37e-27 SMART
cNMP 221 343 1.23e-33 SMART
S_TKc 360 619 5.25e-91 SMART
S_TK_X 620 671 1.55e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000066039
AA Change: V6D

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000093831
Gene: ENSMUSG00000053536
AA Change: V6D

DomainStartEndE-ValueType
RRM 17 90 6.19e-29 SMART
Pfam:CSTF2_hinge 112 191 5.4e-32 PFAM
low complexity region 202 236 N/A INTRINSIC
low complexity region 240 257 N/A INTRINSIC
low complexity region 271 295 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 321 339 N/A INTRINSIC
low complexity region 364 379 N/A INTRINSIC
low complexity region 508 584 N/A INTRINSIC
Pfam:CSTF_C 588 628 7.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073581
SMART Domains Protein: ENSMUSP00000073268
Gene: ENSMUSG00000052920

DomainStartEndE-ValueType
coiled coil region 10 62 N/A INTRINSIC
cNMP 118 231 6.37e-27 SMART
cNMP 236 358 1.23e-33 SMART
S_TKc 375 634 5.25e-91 SMART
S_TK_X 635 686 1.55e-10 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Male mice homozygous for a targeted null allele are infertile due to low sperm counts, significant developmental defects in spermiogenesis, and variable abnormalities in epididymal sperm morphology and motility consistent with oligoasthenoteratozoospermia. Homozygous null females are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8a1 G T 5: 67,667,600 T796K probably benign Het
Atr T C 9: 95,862,863 S78P probably damaging Het
BC017643 A G 11: 121,224,108 probably benign Het
Calb2 C T 8: 110,148,509 probably null Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cdca7 A G 2: 72,479,698 S77G probably damaging Het
Cnot2 C T 10: 116,581,474 probably benign Het
Dido1 T C 2: 180,672,292 I852V probably damaging Het
Dmgdh C T 13: 93,688,630 Q154* probably null Het
Dnah12 T C 14: 26,770,022 F1138S probably damaging Het
Dnah12 G A 14: 26,876,958 A998T possibly damaging Het
Dusp5 T G 19: 53,537,601 Y225D probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam126a T C 5: 23,965,122 T410A probably benign Het
Fam193a G A 5: 34,443,371 D601N probably benign Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Fmo2 T C 1: 162,887,708 K115R probably benign Het
Gak G T 5: 108,576,566 Q1093K probably benign Het
Gm5277 G T 3: 78,892,186 noncoding transcript Het
Gm7173 A T X: 79,509,995 N291K possibly damaging Het
Hgsnat A G 8: 25,968,361 probably null Het
Map3k3 G A 11: 106,148,868 R278H probably damaging Het
Mrvi1 T C 7: 110,923,841 M338V probably benign Het
Muc4 T C 16: 32,736,336 probably benign Het
Nectin3 C A 16: 46,448,590 R483L probably benign Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Ntng1 A G 3: 109,934,996 S154P probably damaging Het
Olfml2b T C 1: 170,669,222 I474T probably benign Het
Olfr1054 C G 2: 86,333,300 D19H probably benign Het
Olfr843 T C 9: 19,249,229 T57A probably damaging Het
Optc G T 1: 133,903,754 T138K possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pard3 C T 8: 127,398,627 P421S probably benign Het
Pcdhb22 G T 18: 37,520,421 E647D probably benign Het
Pclo A G 5: 14,679,992 probably benign Het
Prkce G T 17: 86,490,750 probably null Het
Prr12 T C 7: 45,048,523 D656G unknown Het
Ptprk A T 10: 28,466,052 D485V probably damaging Het
Ptprn2 T C 12: 116,876,000 L381P probably damaging Het
Rnf144b T C 13: 47,207,537 I51T probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Sh3glb2 A T 2: 30,350,699 V118E probably damaging Het
Sipa1l2 C T 8: 125,492,424 G58D probably damaging Het
Slc5a4a C T 10: 76,148,362 A46V probably damaging Het
Tepp T A 8: 95,313,010 Y18* probably null Het
Tgm7 C A 2: 121,098,588 probably null Het
Tjap1 A G 17: 46,258,792 V424A probably benign Het
Trpm6 A T 19: 18,796,500 I414F probably damaging Het
Tsr3 C G 17: 25,241,749 D196E probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Vmn2r97 T A 17: 18,929,071 N240K probably benign Het
Xdh C A 17: 73,898,344 G1042V probably damaging Het
Zcchc4 A G 5: 52,784,067 D68G probably damaging Het
Other mutations in Cstf2t
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01731:Cstf2t APN 19 31084338 missense probably benign 0.00
IGL01739:Cstf2t APN 19 31083136 missense probably damaging 1.00
IGL02466:Cstf2t APN 19 31083877 missense possibly damaging 0.88
R0064:Cstf2t UTSW 19 31083299 missense probably damaging 0.99
R0099:Cstf2t UTSW 19 31083831 missense probably benign 0.00
R0197:Cstf2t UTSW 19 31084626 missense probably benign 0.01
R0423:Cstf2t UTSW 19 31084276 missense possibly damaging 0.89
R0883:Cstf2t UTSW 19 31084626 missense probably benign 0.01
R1753:Cstf2t UTSW 19 31083685 missense possibly damaging 0.52
R2206:Cstf2t UTSW 19 31083775 missense probably benign 0.00
R2291:Cstf2t UTSW 19 31084864 missense probably benign 0.36
R3753:Cstf2t UTSW 19 31083295 missense probably damaging 1.00
R4991:Cstf2t UTSW 19 31084583 missense probably damaging 0.97
R5134:Cstf2t UTSW 19 31084094 missense probably damaging 1.00
R5863:Cstf2t UTSW 19 31083077 missense probably damaging 1.00
R6081:Cstf2t UTSW 19 31083123 missense probably benign 0.10
R6573:Cstf2t UTSW 19 31083780 missense probably benign 0.00
R7408:Cstf2t UTSW 19 31083193 missense possibly damaging 0.94
R7648:Cstf2t UTSW 19 31083592 missense possibly damaging 0.79
R8317:Cstf2t UTSW 19 31084248 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AAATTAGTCCGGTCTCAGGAAGC -3'
(R):5'- AGGTTTCGCATGGCACTGAG -3'

Sequencing Primer
(F):5'- GGTCTCAGGAAGCAGTGTC -3'
(R):5'- GTCTTGGTACTCGCAGAAGC -3'
Posted On2015-08-18