Incidental Mutation 'R4524:Rapgef1'
ID334348
Institutional Source Beutler Lab
Gene Symbol Rapgef1
Ensembl Gene ENSMUSG00000039844
Gene NameRap guanine nucleotide exchange factor (GEF) 1
SynonymsGrf2, 4932418O06Rik, C3G
MMRRC Submission 041766-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4524 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location29619720-29740978 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29679246 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 59 (I59V)
Ref Sequence ENSEMBL: ENSMUSP00000121615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091146] [ENSMUST00000095087] [ENSMUST00000102872] [ENSMUST00000147755]
Predicted Effect probably benign
Transcript: ENSMUST00000091146
AA Change: I59V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088680
Gene: ENSMUSG00000039844
AA Change: I59V

DomainStartEndE-ValueType
low complexity region 191 206 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 468 478 N/A INTRINSIC
low complexity region 510 521 N/A INTRINSIC
low complexity region 592 603 N/A INTRINSIC
low complexity region 664 682 N/A INTRINSIC
low complexity region 689 700 N/A INTRINSIC
low complexity region 727 741 N/A INTRINSIC
RasGEFN 828 970 8.04e-37 SMART
RasGEF 977 1206 5.85e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095087
AA Change: I59V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092703
Gene: ENSMUSG00000039844
AA Change: I59V

DomainStartEndE-ValueType
low complexity region 229 244 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
low complexity region 506 516 N/A INTRINSIC
low complexity region 548 559 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
low complexity region 702 720 N/A INTRINSIC
low complexity region 727 738 N/A INTRINSIC
RasGEFN 834 976 8.04e-37 SMART
RasGEF 983 1212 5.85e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102872
AA Change: I59V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099936
Gene: ENSMUSG00000039844
AA Change: I59V

DomainStartEndE-ValueType
low complexity region 229 244 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
low complexity region 506 516 N/A INTRINSIC
low complexity region 548 559 N/A INTRINSIC
RasGEFN 696 838 8.04e-37 SMART
RasGEF 845 1074 5.85e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147755
AA Change: I59V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121615
Gene: ENSMUSG00000039844
AA Change: I59V

DomainStartEndE-ValueType
low complexity region 191 206 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 468 478 N/A INTRINSIC
low complexity region 510 521 N/A INTRINSIC
low complexity region 591 602 N/A INTRINSIC
low complexity region 663 681 N/A INTRINSIC
Meta Mutation Damage Score 0.0684 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a human guanine nucleotide exchange factor. It transduces signals from CRK by binding the SH3 domain of CRK, and activating several members of the Ras family of GTPases. This signaling cascade that may be involved in apoptosis, integrin-mediated signal transduction, and cell transformation. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die before E7.5. Mice homozygous for a hypomorphic gene trap allele show embryonic lethality during organogenesis, altered neuroepithelium morphology, vascular maturation defects, hemorrhage, and reduced cell migration and adhesion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,302,917 S962G probably benign Het
Ackr2 T C 9: 121,909,543 V328A probably benign Het
Ang4 G T 14: 51,764,148 C114* probably null Het
Arid1b A T 17: 5,097,620 Q599L possibly damaging Het
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Atrnl1 A G 19: 57,630,306 D152G probably damaging Het
BC017643 A G 11: 121,224,108 probably benign Het
Birc6 C T 17: 74,641,777 T3067I probably damaging Het
Bmpr2 T C 1: 59,867,412 S555P probably benign Het
Brox A T 1: 183,292,481 L68I possibly damaging Het
C130026L21Rik A G 5: 111,585,872 noncoding transcript Het
Cavin2 T C 1: 51,301,070 V302A probably benign Het
Cbln3 A T 14: 55,884,065 C41* probably null Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Clec4a2 T A 6: 123,125,084 I66N probably damaging Het
Ddx27 T A 2: 167,027,720 C358* probably null Het
Ehbp1 A T 11: 22,151,843 D228E probably damaging Het
Emc7 T C 2: 112,455,264 V66A probably damaging Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Furin T C 7: 80,398,634 probably null Het
Gm3739 T A 14: 7,299,398 K86* probably null Het
Gmpr A T 13: 45,529,739 E162V probably damaging Het
Gtpbp4 A T 13: 8,974,294 V541D probably benign Het
Myh2 G T 11: 67,176,270 G184W probably damaging Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nrg4 T G 9: 55,227,902 probably benign Het
Ntng1 A G 3: 109,934,996 S154P probably damaging Het
Olfr298 G T 7: 86,488,826 H242N probably damaging Het
Olfr874 T C 9: 37,746,866 L244S possibly damaging Het
Pde7a T A 3: 19,230,976 H349L possibly damaging Het
Pds5b A T 5: 150,788,316 D913V probably damaging Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Ralgapb C A 2: 158,437,306 T104N probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Rsph6a C T 7: 19,066,045 H534Y probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Shcbp1 T C 8: 4,739,193 Y542C probably damaging Het
Shisa8 C G 15: 82,211,962 V151L possibly damaging Het
Slc7a8 G A 14: 54,737,602 T190I probably damaging Het
Spire2 T A 8: 123,360,235 S382T probably benign Het
Stard9 A G 2: 120,696,445 D1061G probably damaging Het
Tex44 T G 1: 86,427,576 D402E probably benign Het
Thbs1 G T 2: 118,122,979 R959L probably damaging Het
Tiam2 A G 17: 3,514,711 D1408G probably damaging Het
Trrap C T 5: 144,825,321 T2352I probably benign Het
Tspyl5 T A 15: 33,687,592 E69V probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Washc1 C T 17: 66,119,092 Q462* probably null Het
Xdh C A 17: 73,898,344 G1042V probably damaging Het
Other mutations in Rapgef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Rapgef1 APN 2 29722269 missense probably benign
IGL00917:Rapgef1 APN 2 29702523 missense probably benign 0.00
IGL02618:Rapgef1 APN 2 29737943 missense probably damaging 1.00
IGL02642:Rapgef1 APN 2 29700860 splice site probably benign
IGL02974:Rapgef1 APN 2 29710216 missense possibly damaging 0.64
R0034:Rapgef1 UTSW 2 29724768 splice site probably benign
R0034:Rapgef1 UTSW 2 29724768 splice site probably benign
R0241:Rapgef1 UTSW 2 29702670 missense possibly damaging 0.53
R0241:Rapgef1 UTSW 2 29702670 missense possibly damaging 0.53
R0279:Rapgef1 UTSW 2 29726227 missense probably damaging 1.00
R0432:Rapgef1 UTSW 2 29679816 missense possibly damaging 0.86
R1817:Rapgef1 UTSW 2 29686256 missense probably damaging 1.00
R1837:Rapgef1 UTSW 2 29737426 missense probably damaging 1.00
R1970:Rapgef1 UTSW 2 29733711 missense probably damaging 1.00
R1980:Rapgef1 UTSW 2 29722227 missense probably benign
R2076:Rapgef1 UTSW 2 29702508 missense probably benign 0.00
R2363:Rapgef1 UTSW 2 29736596 missense possibly damaging 0.63
R3016:Rapgef1 UTSW 2 29707393 missense probably damaging 1.00
R3053:Rapgef1 UTSW 2 29724856 missense probably damaging 1.00
R3777:Rapgef1 UTSW 2 29719689 missense possibly damaging 0.67
R3980:Rapgef1 UTSW 2 29719650 missense probably benign 0.33
R4491:Rapgef1 UTSW 2 29719656 missense possibly damaging 0.93
R4732:Rapgef1 UTSW 2 29689160 missense probably damaging 1.00
R4733:Rapgef1 UTSW 2 29689160 missense probably damaging 1.00
R5391:Rapgef1 UTSW 2 29737965 missense probably damaging 1.00
R5395:Rapgef1 UTSW 2 29737965 missense probably damaging 1.00
R5611:Rapgef1 UTSW 2 29702436 missense probably damaging 0.96
R6062:Rapgef1 UTSW 2 29700732 missense probably damaging 0.96
R6145:Rapgef1 UTSW 2 29736666 missense probably damaging 1.00
R6580:Rapgef1 UTSW 2 29730609 missense possibly damaging 0.95
R6892:Rapgef1 UTSW 2 29699840 critical splice donor site probably null
R6897:Rapgef1 UTSW 2 29702502 missense probably damaging 1.00
R6957:Rapgef1 UTSW 2 29733698 missense possibly damaging 0.62
R7039:Rapgef1 UTSW 2 29726214 missense probably damaging 0.97
R7149:Rapgef1 UTSW 2 29720700 missense probably damaging 0.98
R7253:Rapgef1 UTSW 2 29699721 missense possibly damaging 0.72
R7315:Rapgef1 UTSW 2 29734492 missense probably damaging 0.98
R7956:Rapgef1 UTSW 2 29699015 missense probably benign 0.03
R8161:Rapgef1 UTSW 2 29679198 missense probably benign 0.08
R8162:Rapgef1 UTSW 2 29735999 missense probably damaging 0.99
R8372:Rapgef1 UTSW 2 29710231 missense probably damaging 0.99
R8373:Rapgef1 UTSW 2 29710231 missense probably damaging 0.99
RF005:Rapgef1 UTSW 2 29707195 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTTCAAGGAGGAAGTTTTAGCTTGC -3'
(R):5'- TAAATGCCCAGAGGATGACAC -3'

Sequencing Primer
(F):5'- TTAGCTTGCAGACTCATCAGCTACAG -3'
(R):5'- AGGATGACACGAAACTGTCC -3'
Posted On2015-08-18