Mutagenetix > Incidental Mutation

Incidental Mutation 'R0207:Apcdd1'

33435

Institutional Source

Beutler Lab

Gene Symbol

Apcdd1

Ensembl Gene

ENSMUSG00000071847

Gene Name

adenomatosis polyposis coli down-regulated 1

Synonyms

Drapc1, EIG180

MMRRC Submission

038460-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.129) question?

Stock #

R0207 (G1)

Quality Score

211

Status

Validated

Chromosome

Chromosomal Location

62922327-62953195 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 62950079 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 327 (Y327H)

Ref Sequence

ENSEMBL: ENSMUSP00000125868 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096554] [ENSMUST00000163716]

AlphaFold

Q3U128

Predicted Effect

probably benign
Transcript: ENSMUST00000096554
AA Change: Y327H

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000094302
Gene: ENSMUSG00000071847
AA Change: Y327H

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
APCDDC	51	283	3.3e-140	SMART
APCDDC	284	500	6.26e-91	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163716
AA Change: Y327H

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000125868
Gene: ENSMUSG00000071847
AA Change: Y327H

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
APCDDC	51	283	3.3e-140	SMART
APCDDC	284	500	6.26e-91	SMART

Meta Mutation Damage Score

0.0774

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.2%
20x: 95.5%

Validation Efficiency

95% (76/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an inhibitor of the Wnt signaling pathway. Mutations at this locus have been associated with hereditary hypotrichosis simplex. Increased expression of this gene may also be associated with colorectal carcinogenesis.[provided by RefSeq, Sep 2010]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	A	G	4: 53,086,039	F488S	probably damaging	Het
Acap3	C	T	4: 155,899,424	R116W	probably damaging	Het
Adamts10	C	A	17: 33,545,390	P663T	possibly damaging	Het
Akap12	G	A	10: 4,353,333	G48S	probably damaging	Het
Ankrd7	T	A	6: 18,870,031	M261K	probably benign	Het
Ankzf1	C	A	1: 75,198,304	D599E	possibly damaging	Het
Aox1	T	C	1: 58,105,014	I1278T	possibly damaging	Het
Asxl3	T	A	18: 22,411,496		probably benign	Het
Birc6	C	A	17: 74,662,832		probably benign	Het
Btaf1	T	A	19: 37,009,648	L1714*	probably null	Het
Cacng6	T	A	7: 3,425,004		probably benign	Het
Cdc20b	A	G	13: 113,078,612	D238G	probably damaging	Het
Celf5	T	A	10: 81,470,698	R113W	probably null	Het
Cfap70	C	A	14: 20,412,347	E659D	probably damaging	Het
Clspn	T	A	4: 126,590,598	M1183K	possibly damaging	Het
Dpy19l1	G	A	9: 24,453,891	R275C	probably damaging	Het
Dst	C	T	1: 34,186,935	S1721L	probably benign	Het
Faap100	T	C	11: 120,374,365	T562A	probably damaging	Het
Fam168b	T	C	1: 34,819,688	M133V	probably damaging	Het
Farp2	T	C	1: 93,569,087	I172T	probably damaging	Het
Fer	T	G	17: 63,896,278	S68A	probably damaging	Het
Fmo5	A	G	3: 97,645,681	E315G	probably damaging	Het
Gpr89	A	T	3: 96,871,480	F426I	probably damaging	Het
Hinfp	T	C	9: 44,296,327	I461V	possibly damaging	Het
Hsd11b1	A	T	1: 193,240,248	V167D	probably damaging	Het
Htt	A	G	5: 34,896,908	K2574E	probably benign	Het
I830077J02Rik	A	G	3: 105,926,505	S112P	probably benign	Het
Igf2bp3	T	A	6: 49,105,617	M344L	probably benign	Het
Itch	A	T	2: 155,202,257	Q494L	probably benign	Het
Itga9	T	C	9: 118,769,253		probably benign	Het
Jaml	T	A	9: 45,093,767	D152E	probably benign	Het
Kif22	A	C	7: 127,042,400	M1R	probably null	Het
Kifap3	T	C	1: 163,883,386	Y663H	probably benign	Het
Letm2	T	A	8: 25,578,770	N472I	probably damaging	Het
Mthfr	T	G	4: 148,052,224	V446G	probably damaging	Het
Myh11	T	C	16: 14,211,260	E1206G	possibly damaging	Het
Myo6	G	A	9: 80,288,056	V903I	probably damaging	Het
Myo9b	C	T	8: 71,355,225		probably benign	Het
Nr2f2	G	C	7: 70,360,175	P52R	probably damaging	Het
Nsd3	A	G	8: 25,683,257	N859S	probably benign	Het
Nucb2	C	A	7: 116,536,010	A384E	probably damaging	Het
Ogdhl	C	A	14: 32,342,037		probably null	Het
Olfr119	C	A	17: 37,701,058	C129*	probably null	Het
Olfr1247	G	A	2: 89,609,863	L80F	probably damaging	Het
Olfr1357	T	C	10: 78,611,871	T257A	probably benign	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr381	A	T	11: 73,486,575	L83Q	probably benign	Het
Parp10	C	T	15: 76,242,633	S145N	probably benign	Het
Pigh	A	G	12: 79,083,709		probably benign	Het
Pigo	A	G	4: 43,023,824		probably benign	Het
Pkp4	T	A	2: 59,305,488	V199D	possibly damaging	Het
Polr1e	C	A	4: 45,025,143		probably null	Het
Ppfia3	C	A	7: 45,348,534	R723L	probably damaging	Het
Prex1	C	A	2: 166,585,898	A945S	possibly damaging	Het
Prrt3	A	T	6: 113,495,840	V457E	probably damaging	Het
Rab39	A	G	9: 53,705,971	F49L	possibly damaging	Het
Rrs1	C	A	1: 9,545,762		probably null	Het
Rrs1	G	A	1: 9,545,767	E82K	probably damaging	Het
Serpinb3c	T	C	1: 107,276,992	D8G	probably benign	Het
Slc17a6	A	G	7: 51,646,180		probably benign	Het
Slc24a4	T	A	12: 102,228,951		probably null	Het
Smc1b	C	T	15: 85,123,759	M272I	probably benign	Het
Smc6	T	C	12: 11,283,178		probably benign	Het
Tcf20	T	C	15: 82,855,085	T722A	probably benign	Het
Tesmin	A	T	19: 3,404,088	M141L	probably benign	Het
Tmprss5	T	A	9: 49,113,160	H274Q	possibly damaging	Het
Tns1	C	T	1: 73,937,318		probably null	Het
Tpr	T	C	1: 150,417,427	S868P	possibly damaging	Het
Trank1	C	T	9: 111,366,253	T1115I	probably damaging	Het
Trmt44	A	T	5: 35,572,917	I203K	possibly damaging	Het
Ulk2	A	T	11: 61,777,785	V1037E	probably benign	Het
Usp43	A	G	11: 67,876,499	Y682H	probably damaging	Het
Vipr2	A	T	12: 116,142,882	Q366L	probably damaging	Het
Vmn1r185	C	A	7: 26,611,589	V164L	possibly damaging	Het
Vmn2r120	C	T	17: 57,525,052	V246I	probably benign	Het
Wdr66	T	C	5: 123,283,447	V182A	probably damaging	Het
Wiz	C	T	17: 32,357,033	G790R	probably damaging	Het
Wnk1	A	T	6: 119,952,733	S1016R	probably damaging	Het
Zc3hav1	A	G	6: 38,311,174	L909S	probably benign	Het
Zfp236	T	A	18: 82,640,227	I637F	probably damaging	Het
Zfp788	G	A	7: 41,649,596	G532D	probably damaging	Het
Zranb1	T	C	7: 132,950,385	I255T	probably damaging	Het

Other mutations in Apcdd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00805:Apcdd1	APN	18	62933865	splice site	probably benign
IGL01522:Apcdd1	APN	18	62952115	missense	possibly damaging	0.50
IGL01637:Apcdd1	APN	18	62937286	missense	probably damaging	1.00
IGL02069:Apcdd1	APN	18	62949983	missense	probably damaging	1.00
IGL02183:Apcdd1	APN	18	62951854	missense	probably damaging	0.98
IGL02268:Apcdd1	APN	18	62950188	missense	probably damaging	0.99
IGL02664:Apcdd1	APN	18	62951820	splice site	probably benign
R0363:Apcdd1	UTSW	18	62937097	missense	possibly damaging	0.46
R0540:Apcdd1	UTSW	18	62951896	missense	possibly damaging	0.82
R0567:Apcdd1	UTSW	18	62934036	missense	possibly damaging	0.93
R0607:Apcdd1	UTSW	18	62951896	missense	possibly damaging	0.82
R0629:Apcdd1	UTSW	18	62933970	missense	probably damaging	1.00
R1118:Apcdd1	UTSW	18	62952024	missense	probably benign
R1178:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R1180:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R1181:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R4363:Apcdd1	UTSW	18	62951932	missense	possibly damaging	0.95
R5534:Apcdd1	UTSW	18	62937034	missense	probably benign	0.01
R5622:Apcdd1	UTSW	18	62936902	splice site	probably null
R5771:Apcdd1	UTSW	18	62936956	missense	probably damaging	1.00
R5852:Apcdd1	UTSW	18	62937063	missense	probably damaging	1.00
R5934:Apcdd1	UTSW	18	62951869	missense	possibly damaging	0.72
R6109:Apcdd1	UTSW	18	62937366	missense	probably damaging	1.00
R6515:Apcdd1	UTSW	18	62951839	missense	probably damaging	1.00
R6625:Apcdd1	UTSW	18	62951858	missense	probably damaging	1.00
R6831:Apcdd1	UTSW	18	62950126	nonsense	probably null
R6931:Apcdd1	UTSW	18	62933908	missense	probably damaging	1.00
R7018:Apcdd1	UTSW	18	62937049	missense	probably damaging	0.98
R7115:Apcdd1	UTSW	18	62936953	missense	probably damaging	1.00
R7148:Apcdd1	UTSW	18	62951845	missense	probably damaging	1.00
R7326:Apcdd1	UTSW	18	62952188	nonsense	probably null
R8025:Apcdd1	UTSW	18	62936908	missense	probably damaging	1.00
R8114:Apcdd1	UTSW	18	62950056	missense	probably damaging	1.00
R8261:Apcdd1	UTSW	18	62933903	missense	possibly damaging	0.86
R8404:Apcdd1	UTSW	18	62933915	missense	possibly damaging	0.66
R9015:Apcdd1	UTSW	18	62950086	missense	possibly damaging	0.93
R9040:Apcdd1	UTSW	18	62937343	missense	probably damaging	0.96
R9288:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9295:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9297:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9317:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9319:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9393:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9394:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9396:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9397:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9480:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9520:Apcdd1	UTSW	18	62950119	missense	possibly damaging	0.85
R9521:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9599:Apcdd1	UTSW	18	62950198	critical splice donor site	probably null
X0028:Apcdd1	UTSW	18	62937130	missense	possibly damaging	0.59
Z1088:Apcdd1	UTSW	18	62937183	missense	probably benign	0.18
Z1177:Apcdd1	UTSW	18	62922691	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGCCGCATCATTTTCCGGTCAG -3'
(R):5'- GCAGACATGGCTCTCACTTCATCC -3'

Sequencing Primer
(F):5'- GCATCATTTTCCGGTCAGATGAAC -3'
(R):5'- GCAGCAAAGATACCCTTTCTCTTAG -3'

Posted On

2013-05-09