Incidental Mutation 'R4524:Thbs1'
ID334350
Institutional Source Beutler Lab
Gene Symbol Thbs1
Ensembl Gene ENSMUSG00000040152
Gene Namethrombospondin 1
SynonymsTSP-1, TSP1, tbsp1, Thbs-1
MMRRC Submission 041766-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4524 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location118111876-118127133 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 118122979 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 959 (R959L)
Ref Sequence ENSEMBL: ENSMUSP00000044903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039559]
Predicted Effect probably damaging
Transcript: ENSMUST00000039559
AA Change: R959L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044903
Gene: ENSMUSG00000040152
AA Change: R959L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
TSPN 24 221 2.68e-60 SMART
low complexity region 237 249 N/A INTRINSIC
coiled coil region 292 315 N/A INTRINSIC
VWC 319 373 3.6e-20 SMART
TSP1 383 430 4.21e-12 SMART
TSP1 439 491 3.04e-18 SMART
TSP1 496 548 8.6e-18 SMART
EGF 551 588 3.88e-3 SMART
EGF 592 646 1.69e1 SMART
EGF 650 691 7.13e-2 SMART
Pfam:TSP_3 728 763 5.8e-12 PFAM
Pfam:TSP_3 763 786 2.1e-5 PFAM
Pfam:TSP_3 787 822 3.3e-13 PFAM
Pfam:TSP_3 822 845 1.1e-6 PFAM
Pfam:TSP_3 846 883 2e-15 PFAM
Pfam:TSP_3 884 919 8.3e-13 PFAM
Pfam:TSP_3 920 954 4.9e-10 PFAM
Pfam:TSP_C 973 1170 1.4e-99 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190311
Meta Mutation Damage Score 0.4722 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: The protein encoded by this gene is a subunit of a disulfide-linked homotrimeric protein. This protein is an adhesive glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein can bind to fibrinogen, fibronectin, laminin, type V collagen and integrins alpha-V/beta-1. This protein has been shown to play roles in platelet aggregation, angiogenesis, and tumorigenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice show partial prenatal lethality, lordosis, kyphosis, leukocytosis, multiorgan inflammation, lung hemorrhage, pneumonia, resistance to radiation and ischemic injury, altered blood pressure and vasoactive stress responses, eye pathology, and corneal and lacrimal gland dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,302,917 S962G probably benign Het
Ackr2 T C 9: 121,909,543 V328A probably benign Het
Ang4 G T 14: 51,764,148 C114* probably null Het
Arid1b A T 17: 5,097,620 Q599L possibly damaging Het
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Atrnl1 A G 19: 57,630,306 D152G probably damaging Het
BC017643 A G 11: 121,224,108 probably benign Het
Birc6 C T 17: 74,641,777 T3067I probably damaging Het
Bmpr2 T C 1: 59,867,412 S555P probably benign Het
Brox A T 1: 183,292,481 L68I possibly damaging Het
C130026L21Rik A G 5: 111,585,872 noncoding transcript Het
Cavin2 T C 1: 51,301,070 V302A probably benign Het
Cbln3 A T 14: 55,884,065 C41* probably null Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Clec4a2 T A 6: 123,125,084 I66N probably damaging Het
Ddx27 T A 2: 167,027,720 C358* probably null Het
Ehbp1 A T 11: 22,151,843 D228E probably damaging Het
Emc7 T C 2: 112,455,264 V66A probably damaging Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Furin T C 7: 80,398,634 probably null Het
Gm3739 T A 14: 7,299,398 K86* probably null Het
Gmpr A T 13: 45,529,739 E162V probably damaging Het
Gtpbp4 A T 13: 8,974,294 V541D probably benign Het
Myh2 G T 11: 67,176,270 G184W probably damaging Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nrg4 T G 9: 55,227,902 probably benign Het
Ntng1 A G 3: 109,934,996 S154P probably damaging Het
Olfr298 G T 7: 86,488,826 H242N probably damaging Het
Olfr874 T C 9: 37,746,866 L244S possibly damaging Het
Pde7a T A 3: 19,230,976 H349L possibly damaging Het
Pds5b A T 5: 150,788,316 D913V probably damaging Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Ralgapb C A 2: 158,437,306 T104N probably benign Het
Rapgef1 A G 2: 29,679,246 I59V probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Rsph6a C T 7: 19,066,045 H534Y probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Shcbp1 T C 8: 4,739,193 Y542C probably damaging Het
Shisa8 C G 15: 82,211,962 V151L possibly damaging Het
Slc7a8 G A 14: 54,737,602 T190I probably damaging Het
Spire2 T A 8: 123,360,235 S382T probably benign Het
Stard9 A G 2: 120,696,445 D1061G probably damaging Het
Tex44 T G 1: 86,427,576 D402E probably benign Het
Tiam2 A G 17: 3,514,711 D1408G probably damaging Het
Trrap C T 5: 144,825,321 T2352I probably benign Het
Tspyl5 T A 15: 33,687,592 E69V probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Washc1 C T 17: 66,119,092 Q462* probably null Het
Xdh C A 17: 73,898,344 G1042V probably damaging Het
Other mutations in Thbs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Thbs1 APN 2 118122973 missense probably damaging 1.00
IGL00920:Thbs1 APN 2 118113201 missense probably damaging 0.99
IGL01295:Thbs1 APN 2 118118327 missense possibly damaging 0.88
IGL01649:Thbs1 APN 2 118114982 missense probably benign
IGL02077:Thbs1 APN 2 118113110 missense probably benign 0.00
IGL02251:Thbs1 APN 2 118113518 missense probably benign 0.00
IGL02263:Thbs1 APN 2 118119880 missense probably benign 0.06
IGL02392:Thbs1 APN 2 118114660 missense probably benign
IGL02393:Thbs1 APN 2 118123099 missense possibly damaging 0.87
IGL02411:Thbs1 APN 2 118114970 missense probably benign
IGL02659:Thbs1 APN 2 118114792 missense probably benign 0.29
Stark UTSW 2 118121237 critical splice donor site probably null
R0014:Thbs1 UTSW 2 118113350 missense possibly damaging 0.51
R0042:Thbs1 UTSW 2 118122877 missense probably damaging 1.00
R0064:Thbs1 UTSW 2 118123914 critical splice acceptor site probably null
R0240:Thbs1 UTSW 2 118114393 missense probably damaging 1.00
R0240:Thbs1 UTSW 2 118114393 missense probably damaging 1.00
R0316:Thbs1 UTSW 2 118117574 missense probably damaging 1.00
R0393:Thbs1 UTSW 2 118112991 missense possibly damaging 0.69
R0678:Thbs1 UTSW 2 118122906 missense probably damaging 1.00
R1037:Thbs1 UTSW 2 118123051 missense probably damaging 1.00
R1440:Thbs1 UTSW 2 118114355 missense probably damaging 1.00
R1454:Thbs1 UTSW 2 118122672 missense probably damaging 1.00
R1571:Thbs1 UTSW 2 118119197 missense probably damaging 0.99
R1702:Thbs1 UTSW 2 118113442 missense probably benign
R2035:Thbs1 UTSW 2 118118340 critical splice donor site probably null
R2068:Thbs1 UTSW 2 118123537 nonsense probably null
R2171:Thbs1 UTSW 2 118122579 missense probably damaging 1.00
R2844:Thbs1 UTSW 2 118117628 missense probably benign 0.00
R2870:Thbs1 UTSW 2 118119378 missense probably damaging 1.00
R2870:Thbs1 UTSW 2 118119378 missense probably damaging 1.00
R3620:Thbs1 UTSW 2 118121159 missense probably benign 0.05
R3621:Thbs1 UTSW 2 118121159 missense probably benign 0.05
R3726:Thbs1 UTSW 2 118114710 missense probably benign 0.02
R4499:Thbs1 UTSW 2 118119950 missense possibly damaging 0.82
R4576:Thbs1 UTSW 2 118119416 missense probably damaging 0.97
R4596:Thbs1 UTSW 2 118114755 missense possibly damaging 0.80
R4646:Thbs1 UTSW 2 118118329 missense probably benign 0.15
R4783:Thbs1 UTSW 2 118114792 missense probably benign 0.04
R4836:Thbs1 UTSW 2 118115018 missense possibly damaging 0.91
R4943:Thbs1 UTSW 2 118113449 missense probably damaging 1.00
R4967:Thbs1 UTSW 2 118114778 missense probably benign
R5014:Thbs1 UTSW 2 118120037 critical splice donor site probably null
R5062:Thbs1 UTSW 2 118121237 critical splice donor site probably null
R5363:Thbs1 UTSW 2 118122666 missense probably damaging 1.00
R5420:Thbs1 UTSW 2 118113155 missense possibly damaging 0.83
R5432:Thbs1 UTSW 2 118114683 missense probably benign 0.25
R5788:Thbs1 UTSW 2 118122508 missense probably damaging 1.00
R6221:Thbs1 UTSW 2 118119997 missense probably damaging 1.00
R6327:Thbs1 UTSW 2 118112656 missense unknown
R6466:Thbs1 UTSW 2 118119847 missense probably damaging 1.00
R6480:Thbs1 UTSW 2 118119117 missense probably damaging 1.00
R6794:Thbs1 UTSW 2 118120038 splice site probably null
R6983:Thbs1 UTSW 2 118119952 missense probably damaging 1.00
R7284:Thbs1 UTSW 2 118119356 missense probably damaging 1.00
R7320:Thbs1 UTSW 2 118114957 missense possibly damaging 0.80
R7467:Thbs1 UTSW 2 118118200 missense probably damaging 1.00
R7542:Thbs1 UTSW 2 118121174 missense probably damaging 1.00
R7552:Thbs1 UTSW 2 118113362 missense possibly damaging 0.90
R7575:Thbs1 UTSW 2 118122928 missense probably damaging 1.00
RF039:Thbs1 UTSW 2 118122865 critical splice acceptor site probably benign
RF054:Thbs1 UTSW 2 118122865 critical splice acceptor site probably benign
X0019:Thbs1 UTSW 2 118112982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCACTCATCATAGCAGTTCAG -3'
(R):5'- AATGTTCCCAGATGTCCCG -3'

Sequencing Primer
(F):5'- TCAGAATTTCACTGAACACTTGC -3'
(R):5'- TTCCCAGATGTCCCGAGTGG -3'
Posted On2015-08-18