Incidental Mutation 'R4524:Olfr298'
ID334364
Institutional Source Beutler Lab
Gene Symbol Olfr298
Ensembl Gene ENSMUSG00000062878
Gene Nameolfactory receptor 298
SynonymsGA_x6K02T2NHDJ-9619796-9620794, MOR219-4
MMRRC Submission 041766-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R4524 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location86486322-86492484 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 86488826 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 242 (H242N)
Ref Sequence ENSEMBL: ENSMUSP00000150228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077800] [ENSMUST00000213223] [ENSMUST00000216968] [ENSMUST00000217110]
Predicted Effect probably damaging
Transcript: ENSMUST00000077800
AA Change: H242N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076973
Gene: ENSMUSG00000062878
AA Change: H242N

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 4.2e-37 PFAM
Pfam:7tm_1 39 288 8.4e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213223
AA Change: H242N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000216968
AA Change: H242N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000217110
AA Change: H242N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.6906 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,302,917 S962G probably benign Het
Ackr2 T C 9: 121,909,543 V328A probably benign Het
Ang4 G T 14: 51,764,148 C114* probably null Het
Arid1b A T 17: 5,097,620 Q599L possibly damaging Het
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Atrnl1 A G 19: 57,630,306 D152G probably damaging Het
BC017643 A G 11: 121,224,108 probably benign Het
Birc6 C T 17: 74,641,777 T3067I probably damaging Het
Bmpr2 T C 1: 59,867,412 S555P probably benign Het
Brox A T 1: 183,292,481 L68I possibly damaging Het
C130026L21Rik A G 5: 111,585,872 noncoding transcript Het
Cavin2 T C 1: 51,301,070 V302A probably benign Het
Cbln3 A T 14: 55,884,065 C41* probably null Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Clec4a2 T A 6: 123,125,084 I66N probably damaging Het
Ddx27 T A 2: 167,027,720 C358* probably null Het
Ehbp1 A T 11: 22,151,843 D228E probably damaging Het
Emc7 T C 2: 112,455,264 V66A probably damaging Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Furin T C 7: 80,398,634 probably null Het
Gm3739 T A 14: 7,299,398 K86* probably null Het
Gmpr A T 13: 45,529,739 E162V probably damaging Het
Gtpbp4 A T 13: 8,974,294 V541D probably benign Het
Myh2 G T 11: 67,176,270 G184W probably damaging Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nrg4 T G 9: 55,227,902 probably benign Het
Ntng1 A G 3: 109,934,996 S154P probably damaging Het
Olfr874 T C 9: 37,746,866 L244S possibly damaging Het
Pde7a T A 3: 19,230,976 H349L possibly damaging Het
Pds5b A T 5: 150,788,316 D913V probably damaging Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Ralgapb C A 2: 158,437,306 T104N probably benign Het
Rapgef1 A G 2: 29,679,246 I59V probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Rsph6a C T 7: 19,066,045 H534Y probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Shcbp1 T C 8: 4,739,193 Y542C probably damaging Het
Shisa8 C G 15: 82,211,962 V151L possibly damaging Het
Slc7a8 G A 14: 54,737,602 T190I probably damaging Het
Spire2 T A 8: 123,360,235 S382T probably benign Het
Stard9 A G 2: 120,696,445 D1061G probably damaging Het
Tex44 T G 1: 86,427,576 D402E probably benign Het
Thbs1 G T 2: 118,122,979 R959L probably damaging Het
Tiam2 A G 17: 3,514,711 D1408G probably damaging Het
Trrap C T 5: 144,825,321 T2352I probably benign Het
Tspyl5 T A 15: 33,687,592 E69V probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Washc1 C T 17: 66,119,092 Q462* probably null Het
Xdh C A 17: 73,898,344 G1042V probably damaging Het
Other mutations in Olfr298
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Olfr298 APN 7 86489557 utr 5 prime probably benign
IGL01603:Olfr298 APN 7 86488931 missense possibly damaging 0.92
IGL02389:Olfr298 APN 7 86489128 missense probably damaging 0.98
IGL03146:Olfr298 APN 7 86489194 missense probably damaging 1.00
R0680:Olfr298 UTSW 7 86489337 missense probably benign
R0834:Olfr298 UTSW 7 86489490 missense probably benign 0.11
R1132:Olfr298 UTSW 7 86489217 missense probably benign 0.03
R1519:Olfr298 UTSW 7 86489125 missense probably damaging 0.99
R1881:Olfr298 UTSW 7 86489438 missense probably benign 0.01
R2170:Olfr298 UTSW 7 86488570 missense probably benign 0.03
R4500:Olfr298 UTSW 7 86488919 missense probably benign 0.00
R5184:Olfr298 UTSW 7 86489291 frame shift probably null
R5521:Olfr298 UTSW 7 86488631 missense probably benign 0.08
R7448:Olfr298 UTSW 7 86489209 missense probably damaging 1.00
R7643:Olfr298 UTSW 7 86489568 critical splice acceptor site probably null
R7688:Olfr298 UTSW 7 86488975 missense probably benign 0.01
R8104:Olfr298 UTSW 7 86489023 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAAAGCACGCTTGACATCAC -3'
(R):5'- TGTGGCTCCATTGTGATCC -3'

Sequencing Primer
(F):5'- AAGCACGCTTGACATCACTATTTC -3'
(R):5'- GATGTTCCCTCATTGTTAAGGATC -3'
Posted On2015-08-18