Incidental Mutation 'R4524:Ang4'
ID334380
Institutional Source Beutler Lab
Gene Symbol Ang4
Ensembl Gene ENSMUSG00000060615
Gene Nameangiogenin, ribonuclease A family, member 4
SynonymsRnase5d
MMRRC Submission 041766-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R4524 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location51763878-51773590 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 51764148 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 114 (C114*)
Ref Sequence ENSEMBL: ENSMUSP00000073525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073860]
PDB Structure
Biological and Structural Features of Murine Angiogenin-4, an Angiogenic Protein [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000073860
AA Change: C114*
SMART Domains Protein: ENSMUSP00000073525
Gene: ENSMUSG00000060615
AA Change: C114*

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
RNAse_Pc 25 141 5.34e-61 SMART
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,302,917 S962G probably benign Het
Ackr2 T C 9: 121,909,543 V328A probably benign Het
Arid1b A T 17: 5,097,620 Q599L possibly damaging Het
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Atrnl1 A G 19: 57,630,306 D152G probably damaging Het
BC017643 A G 11: 121,224,108 probably benign Het
Birc6 C T 17: 74,641,777 T3067I probably damaging Het
Bmpr2 T C 1: 59,867,412 S555P probably benign Het
Brox A T 1: 183,292,481 L68I possibly damaging Het
C130026L21Rik A G 5: 111,585,872 noncoding transcript Het
Cavin2 T C 1: 51,301,070 V302A probably benign Het
Cbln3 A T 14: 55,884,065 C41* probably null Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Clec4a2 T A 6: 123,125,084 I66N probably damaging Het
Ddx27 T A 2: 167,027,720 C358* probably null Het
Ehbp1 A T 11: 22,151,843 D228E probably damaging Het
Emc7 T C 2: 112,455,264 V66A probably damaging Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Furin T C 7: 80,398,634 probably null Het
Gm3739 T A 14: 7,299,398 K86* probably null Het
Gmpr A T 13: 45,529,739 E162V probably damaging Het
Gtpbp4 A T 13: 8,974,294 V541D probably benign Het
Myh2 G T 11: 67,176,270 G184W probably damaging Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nrg4 T G 9: 55,227,902 probably benign Het
Ntng1 A G 3: 109,934,996 S154P probably damaging Het
Olfr298 G T 7: 86,488,826 H242N probably damaging Het
Olfr874 T C 9: 37,746,866 L244S possibly damaging Het
Pde7a T A 3: 19,230,976 H349L possibly damaging Het
Pds5b A T 5: 150,788,316 D913V probably damaging Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Ralgapb C A 2: 158,437,306 T104N probably benign Het
Rapgef1 A G 2: 29,679,246 I59V probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Rsph6a C T 7: 19,066,045 H534Y probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Shcbp1 T C 8: 4,739,193 Y542C probably damaging Het
Shisa8 C G 15: 82,211,962 V151L possibly damaging Het
Slc7a8 G A 14: 54,737,602 T190I probably damaging Het
Spire2 T A 8: 123,360,235 S382T probably benign Het
Stard9 A G 2: 120,696,445 D1061G probably damaging Het
Tex44 T G 1: 86,427,576 D402E probably benign Het
Thbs1 G T 2: 118,122,979 R959L probably damaging Het
Tiam2 A G 17: 3,514,711 D1408G probably damaging Het
Trrap C T 5: 144,825,321 T2352I probably benign Het
Tspyl5 T A 15: 33,687,592 E69V probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Washc1 C T 17: 66,119,092 Q462* probably null Het
Xdh C A 17: 73,898,344 G1042V probably damaging Het
Other mutations in Ang4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Ang4 APN 14 51764179 missense probably benign 0.11
IGL01393:Ang4 APN 14 51764213 missense probably benign 0.00
IGL02023:Ang4 APN 14 51764054 utr 3 prime probably benign
IGL02645:Ang4 APN 14 51764347 missense probably damaging 1.00
R0023:Ang4 UTSW 14 51764403 nonsense probably null
R0834:Ang4 UTSW 14 51764268 missense probably benign
R1076:Ang4 UTSW 14 51764302 missense probably damaging 1.00
R2258:Ang4 UTSW 14 51764498 start gained probably benign
R4981:Ang4 UTSW 14 51764372 missense probably benign 0.11
R5929:Ang4 UTSW 14 51764251 missense probably damaging 1.00
R7840:Ang4 UTSW 14 51764072 missense probably damaging 1.00
Z1176:Ang4 UTSW 14 51764148 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGCTGAACCAGTGATCATGG -3'
(R):5'- CACTATGATGCCAAGCCAAATGG -3'

Sequencing Primer
(F):5'- AACCAGTGATCATGGCTGTG -3'
(R):5'- AGGAAAGAAAGCTAACCTCGC -3'
Posted On2015-08-18