Incidental Mutation 'R4525:Tas2r140'
ID334408
Institutional Source Beutler Lab
Gene Symbol Tas2r140
Ensembl Gene ENSMUSG00000071147
Gene Nametaste receptor, type 2, member 140
SynonymsTas2r40, TRB5, T2R40, TRB3, mTRB3, Tas2r13, mt2r64
MMRRC Submission 041767-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R4525 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location133054817-133055816 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 133055244 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 184 (T184A)
Ref Sequence ENSEMBL: ENSMUSP00000093040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095391]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095391
AA Change: T184A

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000093040
Gene: ENSMUSG00000071147
AA Change: T184A

DomainStartEndE-ValueType
Pfam:TAS2R 1 301 6.7e-86 PFAM
Meta Mutation Damage Score 0.1384 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik A G 2: 32,574,376 probably benign Het
Ampd1 T C 3: 103,094,733 V510A probably damaging Het
Aoc1 A G 6: 48,906,675 Y495C probably damaging Het
Asap2 G A 12: 21,229,292 probably null Het
Cd47 T C 16: 49,867,792 V25A probably benign Het
Cer1 A G 4: 82,884,669 F139L possibly damaging Het
Cpne3 G T 4: 19,523,206 P527H probably damaging Het
Erbin T C 13: 103,857,092 I347V probably benign Het
Gm17542 T C 10: 58,713,613 D31G probably null Het
Hivep1 T A 13: 42,155,813 C510S probably benign Het
Hnrnpk A G 13: 58,393,882 probably benign Het
Iqcf4 T A 9: 106,570,628 Q27H possibly damaging Het
Kcna4 C A 2: 107,295,065 T48K possibly damaging Het
Loxhd1 T A 18: 77,356,912 C336S probably damaging Het
Ltbp3 A G 19: 5,746,359 T306A probably benign Het
Oplah G T 15: 76,305,509 L176M probably damaging Het
Pon1 T C 6: 5,177,412 probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,926 probably benign Het
Ryr3 A G 2: 112,653,621 I3932T probably damaging Het
Shank1 A T 7: 44,354,590 H1902L possibly damaging Het
Sipa1 T A 19: 5,651,957 Q947L probably benign Het
Slit2 G T 5: 48,249,873 C882F probably damaging Het
Speer4a A T 5: 26,039,343 probably null Het
Spta1 A G 1: 174,207,110 D1035G probably null Het
Timm10b A G 7: 105,682,806 N828S probably benign Het
Tmem161b T C 13: 84,257,802 I50T probably benign Het
Tnpo3 T C 6: 29,561,398 N628D probably benign Het
Tnrc6a A G 7: 123,179,782 T102A probably benign Het
Vmn2r70 A T 7: 85,559,579 N563K probably damaging Het
Other mutations in Tas2r140
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0244:Tas2r140 UTSW 6 133055327 missense possibly damaging 0.46
R0666:Tas2r140 UTSW 6 133055442 missense probably benign 0.22
R1174:Tas2r140 UTSW 6 133054871 missense probably benign 0.27
R1237:Tas2r140 UTSW 6 133055208 missense probably benign 0.04
R1553:Tas2r140 UTSW 6 133055508 missense probably damaging 0.99
R2030:Tas2r140 UTSW 6 133055250 missense probably benign 0.23
R3123:Tas2r140 UTSW 6 133055241 missense probably benign 0.05
R3124:Tas2r140 UTSW 6 133055241 missense probably benign 0.05
R4233:Tas2r140 UTSW 6 133054952 missense probably damaging 1.00
R4234:Tas2r140 UTSW 6 133054952 missense probably damaging 1.00
R4236:Tas2r140 UTSW 6 133054952 missense probably damaging 1.00
R4803:Tas2r140 UTSW 6 133055780 missense possibly damaging 0.77
R4840:Tas2r140 UTSW 6 133055565 missense probably benign 0.01
R5317:Tas2r140 UTSW 6 133055580 missense probably benign 0.06
R5937:Tas2r140 UTSW 6 133055273 missense probably benign 0.01
R6142:Tas2r140 UTSW 6 133055735 missense probably damaging 1.00
R7127:Tas2r140 UTSW 6 133054959 missense possibly damaging 0.62
R7143:Tas2r140 UTSW 6 133055519 missense probably benign 0.00
R7178:Tas2r140 UTSW 6 133055660 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATTGCATGACAAGTGCCAG -3'
(R):5'- GCTTGCTACATGTCTCAGCATC -3'

Sequencing Primer
(F):5'- CATGACAAGTGCCAGAAAGAAAATG -3'
(R):5'- CTATTTTTCTTTCCCTAAGGTGGAG -3'
Posted On2015-08-18