Incidental Mutation 'R4526:Lcn9'
ID334429
Institutional Source Beutler Lab
Gene Symbol Lcn9
Ensembl Gene ENSMUSG00000023210
Gene Namelipocalin 9
Synonyms
MMRRC Submission 041591-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R4526 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location25823153-25825537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 25824508 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 128 (K128T)
Ref Sequence ENSEMBL: ENSMUSP00000023978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023978]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023978
AA Change: K128T

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023978
Gene: ENSMUSG00000023210
AA Change: K128T

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Lipocalin 34 174 6e-37 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the lipocalin family, such as LCN9, have a common structure consisting of an 8-stranded antiparallel beta-barrel that forms a cup-shaped ligand-binding pocket or calyx. Lipocalins generally bind small hydrophobic ligands and transport them to specific cells (Suzuki et al., 2004 [PubMed 15363845]).[supplied by OMIM, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,096,578 R178C probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adgre4 C A 17: 55,785,016 S92* probably null Het
Arl13b T C 16: 62,812,011 D73G probably damaging Het
Cbwd1 A G 19: 24,957,964 Y59H probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Crebzf A C 7: 90,443,760 E16A possibly damaging Het
D430041D05Rik A G 2: 104,192,433 probably null Het
Dnah1 C A 14: 31,285,998 D2151Y probably benign Het
Gli3 A G 13: 15,713,631 K544E probably damaging Het
Gm17542 T C 10: 58,713,613 D31G probably null Het
Lman2l T C 1: 36,438,763 E164G probably damaging Het
Lpin2 T A 17: 71,237,378 probably null Het
Ly75 G A 2: 60,330,773 T900M probably benign Het
Mapk15 A T 15: 75,995,255 I74F possibly damaging Het
Myh10 C T 11: 68,815,049 T2007I probably benign Het
Nek1 T C 8: 61,106,944 S937P probably damaging Het
Oas1b T A 5: 120,822,102 probably null Het
Olfr1098 C T 2: 86,922,995 C179Y possibly damaging Het
Olfr1156 T C 2: 87,949,409 T275A probably benign Het
Olfr1269 T C 2: 90,118,672 K309E probably benign Het
Otogl G A 10: 107,886,980 P297S probably damaging Het
Plekhm1 A G 11: 103,395,304 S102P probably damaging Het
Plvap G A 8: 71,507,771 R334W probably damaging Het
Polr2b T G 5: 77,326,714 V466G probably damaging Het
Ptpn13 T C 5: 103,501,469 I246T probably benign Het
Rims2 A T 15: 39,437,717 K281N probably damaging Het
Scamp4 T C 10: 80,611,057 F108S probably damaging Het
Snrnp200 A G 2: 127,229,102 N1101S probably benign Het
Sntb2 C A 8: 107,009,963 L490M probably damaging Het
Ssu2 A G 6: 112,382,422 V79A possibly damaging Het
Stard7 A G 2: 127,297,208 S347G probably benign Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r6 A G 3: 64,537,724 V860A probably benign Het
Vmn2r60 A G 7: 42,195,243 T677A probably damaging Het
Zfp318 T A 17: 46,412,358 H1762Q probably benign Het
Zmynd8 TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 2: 165,807,607 probably benign Het
Other mutations in Lcn9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01952:Lcn9 APN 2 25824538 missense probably damaging 1.00
IGL02417:Lcn9 APN 2 25823680 missense possibly damaging 0.91
PIT4418001:Lcn9 UTSW 2 25824541 missense probably damaging 1.00
R1479:Lcn9 UTSW 2 25823703 splice site probably benign
R1657:Lcn9 UTSW 2 25824710 missense probably benign 0.17
R4199:Lcn9 UTSW 2 25824761 missense probably benign 0.15
R4570:Lcn9 UTSW 2 25823579 missense probably benign 0.04
R5232:Lcn9 UTSW 2 25824055 critical splice donor site probably null
R5577:Lcn9 UTSW 2 25823651 missense probably damaging 1.00
R5849:Lcn9 UTSW 2 25823256 critical splice donor site probably null
R6059:Lcn9 UTSW 2 25824725 missense possibly damaging 0.62
R7748:Lcn9 UTSW 2 25824914 makesense probably null
Predicted Primers PCR Primer
(F):5'- GCACTGGGCATTCAAACTCTC -3'
(R):5'- AGTCTTGTCAAGCAGTATGGAG -3'

Sequencing Primer
(F):5'- CCTTCCAATGCTTGCTTTAACAGAAG -3'
(R):5'- TCAAGCAGTATGGAGCGCCC -3'
Posted On2015-08-18