Incidental Mutation 'R4526:Plvap'
ID334447
Institutional Source Beutler Lab
Gene Symbol Plvap
Ensembl Gene ENSMUSG00000034845
Gene Nameplasmalemma vesicle associated protein
SynonymsPV-1, MECA32
MMRRC Submission 041591-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4526 (G1)
Quality Score111
Status Not validated
Chromosome8
Chromosomal Location71497765-71511752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 71507771 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 334 (R334W)
Ref Sequence ENSEMBL: ENSMUSP00000035404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048452]
Predicted Effect probably damaging
Transcript: ENSMUST00000048452
AA Change: R334W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035404
Gene: ENSMUSG00000034845
AA Change: R334W

DomainStartEndE-ValueType
Pfam:PV-1 1 436 1.1e-231 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display background sensitive lethality, absence of diaphragms from fenestrated endothelia, increased vascular permeability, hypoproteinemia, ascites, edema, xanthoma and increased plasma triglyceride levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,096,578 R178C probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adgre4 C A 17: 55,785,016 S92* probably null Het
Arl13b T C 16: 62,812,011 D73G probably damaging Het
Cbwd1 A G 19: 24,957,964 Y59H probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Crebzf A C 7: 90,443,760 E16A possibly damaging Het
D430041D05Rik A G 2: 104,192,433 probably null Het
Dnah1 C A 14: 31,285,998 D2151Y probably benign Het
Gli3 A G 13: 15,713,631 K544E probably damaging Het
Gm17542 T C 10: 58,713,613 D31G probably null Het
Lcn9 A C 2: 25,824,508 K128T possibly damaging Het
Lman2l T C 1: 36,438,763 E164G probably damaging Het
Lpin2 T A 17: 71,237,378 probably null Het
Ly75 G A 2: 60,330,773 T900M probably benign Het
Mapk15 A T 15: 75,995,255 I74F possibly damaging Het
Myh10 C T 11: 68,815,049 T2007I probably benign Het
Nek1 T C 8: 61,106,944 S937P probably damaging Het
Oas1b T A 5: 120,822,102 probably null Het
Olfr1098 C T 2: 86,922,995 C179Y possibly damaging Het
Olfr1156 T C 2: 87,949,409 T275A probably benign Het
Olfr1269 T C 2: 90,118,672 K309E probably benign Het
Otogl G A 10: 107,886,980 P297S probably damaging Het
Plekhm1 A G 11: 103,395,304 S102P probably damaging Het
Polr2b T G 5: 77,326,714 V466G probably damaging Het
Ptpn13 T C 5: 103,501,469 I246T probably benign Het
Rims2 A T 15: 39,437,717 K281N probably damaging Het
Scamp4 T C 10: 80,611,057 F108S probably damaging Het
Snrnp200 A G 2: 127,229,102 N1101S probably benign Het
Sntb2 C A 8: 107,009,963 L490M probably damaging Het
Ssu2 A G 6: 112,382,422 V79A possibly damaging Het
Stard7 A G 2: 127,297,208 S347G probably benign Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r6 A G 3: 64,537,724 V860A probably benign Het
Vmn2r60 A G 7: 42,195,243 T677A probably damaging Het
Zfp318 T A 17: 46,412,358 H1762Q probably benign Het
Zmynd8 TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 2: 165,807,607 probably benign Het
Other mutations in Plvap
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0281:Plvap UTSW 8 71511382 missense probably damaging 1.00
R0848:Plvap UTSW 8 71506882 missense probably damaging 1.00
R1466:Plvap UTSW 8 71508481 missense probably benign
R1466:Plvap UTSW 8 71508481 missense probably benign
R1491:Plvap UTSW 8 71511472 missense probably damaging 1.00
R1584:Plvap UTSW 8 71508481 missense probably benign
R4777:Plvap UTSW 8 71507986 missense probably benign 0.19
R4939:Plvap UTSW 8 71511439 missense probably benign 0.02
R5275:Plvap UTSW 8 71511670 missense probably benign
R5295:Plvap UTSW 8 71511670 missense probably benign
R5439:Plvap UTSW 8 71511451 missense probably damaging 0.98
R5513:Plvap UTSW 8 71511529 missense probably damaging 1.00
R7229:Plvap UTSW 8 71511577 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCCACCATCCCTGCTAAGAG -3'
(R):5'- CAAGATAGAAGAGCTGGCCC -3'

Sequencing Primer
(F):5'- AGCTTCCCTTCCTCAGAGG -3'
(R):5'- CCGTGAGAATGCAGAACT -3'
Posted On2015-08-18