Incidental Mutation 'R4526:Arl13b'
ID334459
Institutional Source Beutler Lab
Gene Symbol Arl13b
Ensembl Gene ENSMUSG00000022911
Gene NameADP-ribosylation factor-like 13B
Synonymshnn, A930014M17Rik, Arl2l1, A530097K21Rik, C530009C10Rik
MMRRC Submission 041591-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4526 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location62793685-62847040 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62812011 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 73 (D73G)
Ref Sequence ENSEMBL: ENSMUSP00000156207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055557] [ENSMUST00000089289] [ENSMUST00000232561]
Predicted Effect probably benign
Transcript: ENSMUST00000055557
SMART Domains Protein: ENSMUSP00000055901
Gene: ENSMUSG00000047854

DomainStartEndE-ValueType
Blast:SynN 51 161 4e-18 BLAST
t_SNARE 202 269 3.21e-9 SMART
low complexity region 277 289 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000089289
AA Change: D176G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086703
Gene: ENSMUSG00000022911
AA Change: D176G

DomainStartEndE-ValueType
Pfam:Arf 8 190 8.2e-43 PFAM
Pfam:SRPRB 19 157 7.1e-8 PFAM
Pfam:Roc 23 134 5.4e-9 PFAM
Pfam:Ras 23 183 3.1e-10 PFAM
low complexity region 207 233 N/A INTRINSIC
low complexity region 265 281 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
low complexity region 344 349 N/A INTRINSIC
low complexity region 366 388 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102469
Predicted Effect probably damaging
Transcript: ENSMUST00000232561
AA Change: D73G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADP-ribosylation factor-like family. The encoded protein is a small GTPase that contains both N-terminal and C-terminal guanine nucleotide-binding motifs. This protein is localized in the cilia and plays a role in cilia formation and in maintenance of cilia. Mutations in this gene are the cause of Joubert syndrome 8. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for an ENU-induced mutation die at E13-E14 exhibiting left-right randomization and absence of the floor plate in the caudal spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,096,578 R178C probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adgre4 C A 17: 55,785,016 S92* probably null Het
Cbwd1 A G 19: 24,957,964 Y59H probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Crebzf A C 7: 90,443,760 E16A possibly damaging Het
D430041D05Rik A G 2: 104,192,433 probably null Het
Dnah1 C A 14: 31,285,998 D2151Y probably benign Het
Gli3 A G 13: 15,713,631 K544E probably damaging Het
Gm17542 T C 10: 58,713,613 D31G probably null Het
Lcn9 A C 2: 25,824,508 K128T possibly damaging Het
Lman2l T C 1: 36,438,763 E164G probably damaging Het
Lpin2 T A 17: 71,237,378 probably null Het
Ly75 G A 2: 60,330,773 T900M probably benign Het
Mapk15 A T 15: 75,995,255 I74F possibly damaging Het
Myh10 C T 11: 68,815,049 T2007I probably benign Het
Nek1 T C 8: 61,106,944 S937P probably damaging Het
Oas1b T A 5: 120,822,102 probably null Het
Olfr1098 C T 2: 86,922,995 C179Y possibly damaging Het
Olfr1156 T C 2: 87,949,409 T275A probably benign Het
Olfr1269 T C 2: 90,118,672 K309E probably benign Het
Otogl G A 10: 107,886,980 P297S probably damaging Het
Plekhm1 A G 11: 103,395,304 S102P probably damaging Het
Plvap G A 8: 71,507,771 R334W probably damaging Het
Polr2b T G 5: 77,326,714 V466G probably damaging Het
Ptpn13 T C 5: 103,501,469 I246T probably benign Het
Rims2 A T 15: 39,437,717 K281N probably damaging Het
Scamp4 T C 10: 80,611,057 F108S probably damaging Het
Snrnp200 A G 2: 127,229,102 N1101S probably benign Het
Sntb2 C A 8: 107,009,963 L490M probably damaging Het
Ssu2 A G 6: 112,382,422 V79A possibly damaging Het
Stard7 A G 2: 127,297,208 S347G probably benign Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r6 A G 3: 64,537,724 V860A probably benign Het
Vmn2r60 A G 7: 42,195,243 T677A probably damaging Het
Zfp318 T A 17: 46,412,358 H1762Q probably benign Het
Zmynd8 TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 2: 165,807,607 probably benign Het
Other mutations in Arl13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01659:Arl13b APN 16 62802750 missense possibly damaging 0.47
IGL02994:Arl13b APN 16 62812003 missense probably damaging 1.00
R0499:Arl13b UTSW 16 62801733 missense probably benign 0.03
R1484:Arl13b UTSW 16 62806636 missense probably benign
R1618:Arl13b UTSW 16 62813277 splice site probably null
R1637:Arl13b UTSW 16 62830784 missense probably damaging 1.00
R1656:Arl13b UTSW 16 62806644 missense possibly damaging 0.53
R4927:Arl13b UTSW 16 62801787 missense probably damaging 1.00
R7127:Arl13b UTSW 16 62801739 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAACAGGTTAAAGCTGC -3'
(R):5'- CAGGCAGTTCAGTTTGTCTTC -3'

Sequencing Primer
(F):5'- GGTTAAAGCTGCCCTTTTTAATATTC -3'
(R):5'- GGCTAAATTTTGCTTTTCCAA -3'
Posted On2015-08-18