Incidental Mutation 'R4526:Lpin2'
ID334462
Institutional Source Beutler Lab
Gene Symbol Lpin2
Ensembl Gene ENSMUSG00000024052
Gene Namelipin 2
Synonyms2610511G02Rik
MMRRC Submission 041591-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.337) question?
Stock #R4526 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location71182560-71249817 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 71237378 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126681] [ENSMUST00000126681] [ENSMUST00000129635] [ENSMUST00000129635]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000053173
Predicted Effect probably null
Transcript: ENSMUST00000126681
SMART Domains Protein: ENSMUSP00000118610
Gene: ENSMUSG00000024052

DomainStartEndE-ValueType
Pfam:Lipin_N 39 148 1e-47 PFAM
low complexity region 191 206 N/A INTRINSIC
low complexity region 217 227 N/A INTRINSIC
low complexity region 398 420 N/A INTRINSIC
Pfam:Lipin_mid 504 596 6.1e-37 PFAM
LNS2 720 876 2.18e-107 SMART
low complexity region 924 930 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000126681
SMART Domains Protein: ENSMUSP00000118610
Gene: ENSMUSG00000024052

DomainStartEndE-ValueType
Pfam:Lipin_N 39 148 1e-47 PFAM
low complexity region 191 206 N/A INTRINSIC
low complexity region 217 227 N/A INTRINSIC
low complexity region 398 420 N/A INTRINSIC
Pfam:Lipin_mid 504 596 6.1e-37 PFAM
LNS2 720 876 2.18e-107 SMART
low complexity region 924 930 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000129635
SMART Domains Protein: ENSMUSP00000119282
Gene: ENSMUSG00000024052

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.2e-53 PFAM
low complexity region 153 168 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
low complexity region 360 382 N/A INTRINSIC
LNS2 682 838 2.18e-107 SMART
low complexity region 886 892 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000129635
SMART Domains Protein: ENSMUSP00000119282
Gene: ENSMUSG00000024052

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.2e-53 PFAM
low complexity region 153 168 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
low complexity region 360 382 N/A INTRINSIC
LNS2 682 838 2.18e-107 SMART
low complexity region 886 892 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140150
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142842
Predicted Effect probably benign
Transcript: ENSMUST00000154507
SMART Domains Protein: ENSMUSP00000127035
Gene: ENSMUSG00000024052

DomainStartEndE-ValueType
Pfam:Lipin_mid 1 55 2.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mouse studies suggest that this gene functions during normal adipose tissue development and may play a role in human triglyceride metabolism. This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop ataxia, impaired blance, and tremors with age and show altered cerebellar phospholipid composition and anemia. Mice show diet-induced hepatic triglyceride accumulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,096,578 R178C probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adgre4 C A 17: 55,785,016 S92* probably null Het
Arl13b T C 16: 62,812,011 D73G probably damaging Het
Cbwd1 A G 19: 24,957,964 Y59H probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Crebzf A C 7: 90,443,760 E16A possibly damaging Het
D430041D05Rik A G 2: 104,192,433 probably null Het
Dnah1 C A 14: 31,285,998 D2151Y probably benign Het
Gli3 A G 13: 15,713,631 K544E probably damaging Het
Gm17542 T C 10: 58,713,613 D31G probably null Het
Lcn9 A C 2: 25,824,508 K128T possibly damaging Het
Lman2l T C 1: 36,438,763 E164G probably damaging Het
Ly75 G A 2: 60,330,773 T900M probably benign Het
Mapk15 A T 15: 75,995,255 I74F possibly damaging Het
Myh10 C T 11: 68,815,049 T2007I probably benign Het
Nek1 T C 8: 61,106,944 S937P probably damaging Het
Oas1b T A 5: 120,822,102 probably null Het
Olfr1098 C T 2: 86,922,995 C179Y possibly damaging Het
Olfr1156 T C 2: 87,949,409 T275A probably benign Het
Olfr1269 T C 2: 90,118,672 K309E probably benign Het
Otogl G A 10: 107,886,980 P297S probably damaging Het
Plekhm1 A G 11: 103,395,304 S102P probably damaging Het
Plvap G A 8: 71,507,771 R334W probably damaging Het
Polr2b T G 5: 77,326,714 V466G probably damaging Het
Ptpn13 T C 5: 103,501,469 I246T probably benign Het
Rims2 A T 15: 39,437,717 K281N probably damaging Het
Scamp4 T C 10: 80,611,057 F108S probably damaging Het
Snrnp200 A G 2: 127,229,102 N1101S probably benign Het
Sntb2 C A 8: 107,009,963 L490M probably damaging Het
Ssu2 A G 6: 112,382,422 V79A possibly damaging Het
Stard7 A G 2: 127,297,208 S347G probably benign Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r6 A G 3: 64,537,724 V860A probably benign Het
Vmn2r60 A G 7: 42,195,243 T677A probably damaging Het
Zfp318 T A 17: 46,412,358 H1762Q probably benign Het
Zmynd8 TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 2: 165,807,607 probably benign Het
Other mutations in Lpin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Lpin2 APN 17 71243972 missense probably damaging 1.00
IGL01712:Lpin2 APN 17 71215068 missense probably damaging 1.00
IGL01727:Lpin2 APN 17 71246452 missense probably damaging 1.00
IGL01969:Lpin2 APN 17 71231507 missense probably benign 0.00
IGL02143:Lpin2 APN 17 71243926 missense probably damaging 1.00
IGL02600:Lpin2 APN 17 71238698 missense probably damaging 0.99
IGL02931:Lpin2 APN 17 71238683 missense probably damaging 1.00
aspen UTSW 17 71243970 nonsense probably null
R0144:Lpin2 UTSW 17 71225076 missense probably damaging 1.00
R0165:Lpin2 UTSW 17 71246519 missense probably damaging 1.00
R0367:Lpin2 UTSW 17 71215022 missense probably damaging 1.00
R0648:Lpin2 UTSW 17 71229312 missense probably benign 0.01
R1564:Lpin2 UTSW 17 71225060 missense probably benign 0.01
R1570:Lpin2 UTSW 17 71245181 nonsense probably null
R1846:Lpin2 UTSW 17 71225069 missense probably benign 0.00
R3607:Lpin2 UTSW 17 71229392 missense probably damaging 1.00
R4006:Lpin2 UTSW 17 71246501 missense probably damaging 1.00
R4705:Lpin2 UTSW 17 71232143 unclassified probably benign
R4949:Lpin2 UTSW 17 71231339 missense probably damaging 1.00
R4970:Lpin2 UTSW 17 71231334 missense probably damaging 0.98
R5099:Lpin2 UTSW 17 71243970 nonsense probably null
R5100:Lpin2 UTSW 17 71243970 nonsense probably null
R5101:Lpin2 UTSW 17 71243970 nonsense probably null
R5152:Lpin2 UTSW 17 71245159 missense probably damaging 1.00
R5216:Lpin2 UTSW 17 71242760 missense probably damaging 1.00
R5321:Lpin2 UTSW 17 71246858 missense probably damaging 1.00
R5457:Lpin2 UTSW 17 71243372 missense probably damaging 1.00
R5695:Lpin2 UTSW 17 71244803 missense probably damaging 1.00
R5786:Lpin2 UTSW 17 71230273 missense probably benign 0.03
R5869:Lpin2 UTSW 17 71232276 unclassified probably benign
R5894:Lpin2 UTSW 17 71246934 missense probably benign 0.39
R6116:Lpin2 UTSW 17 71243930 missense probably damaging 1.00
R6253:Lpin2 UTSW 17 71231269 missense probably damaging 1.00
R6280:Lpin2 UTSW 17 71232248 unclassified probably benign
R6443:Lpin2 UTSW 17 71241668 missense probably benign 0.25
R6528:Lpin2 UTSW 17 71244005 missense probably damaging 1.00
R6634:Lpin2 UTSW 17 71246418 missense probably damaging 1.00
R6828:Lpin2 UTSW 17 71222128 missense probably damaging 1.00
R6885:Lpin2 UTSW 17 71215150 missense probably damaging 1.00
R6930:Lpin2 UTSW 17 71244791 missense probably damaging 1.00
R7067:Lpin2 UTSW 17 71244858 missense possibly damaging 0.72
R7583:Lpin2 UTSW 17 71231396 nonsense probably null
R7806:Lpin2 UTSW 17 71245171 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCCATTGTGAAGTGTTTTCTAC -3'
(R):5'- ATTCTCACTGAGGCCTCCACAG -3'

Sequencing Primer
(F):5'- GGTAGACAGATCCAGGTACTCTC -3'
(R):5'- TCCACAGAGGGAGAGGGTTACATC -3'
Posted On2015-08-18