Mutagenetix > Incidental Mutation

Incidental Mutation 'R4527:Pask'

334467

Institutional Source

Beutler Lab

Gene Symbol

Pask

Ensembl Gene

ENSMUSG00000026274

Gene Name

PAS domain containing serine/threonine kinase

Synonyms

Paskin

MMRRC Submission

041768-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.088) question?

Stock #

R4527 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

93308770-93343482 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 93320502 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 1026 (F1026L)

Ref Sequence

ENSEMBL: ENSMUSP00000027493 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027493]

AlphaFold

Q8CEE6

Predicted Effect

probably benign
Transcript: ENSMUST00000027493
AA Change: F1026L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000027493
Gene: ENSMUSG00000026274
AA Change: F1026L

Domain	Start	End	E-Value	Type
PAS	119	186	3.87e-8	SMART
PAS	333	400	3.08e-2	SMART
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1043	1054	N/A	INTRINSIC
S_TKc	1059	1311	8.16e-79	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128655

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139028

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188069

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine kinase family that contains two PAS domains. Expression of this gene is regulated by glucose, and the encoded protein plays a role in the regulation of insulin gene expression. Downregulation of this gene may play a role in type 2 diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mice display resistance to diet-induced obesity, impaired glucose stimulated insulin secretion, abnormal energy balance, and abnormalities in hypoxia induced changes in ventialtion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agfg2	A	G	5: 137,684,536	V15A	unknown	Het
Asb3	A	G	11: 31,058,933	D278G	probably benign	Het
Atrn	T	C	2: 130,973,504	I780T	probably benign	Het
Car2	C	T	3: 14,898,005	P200L	probably damaging	Het
Cars	A	T	7: 143,565,049	M668K	probably benign	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Cer1	A	G	4: 82,884,669	F139L	possibly damaging	Het
Crhr2	T	A	6: 55,132,853		probably benign	Het
Dnah7c	G	A	1: 46,532,931	E855K	probably benign	Het
Espn	C	T	4: 152,135,649	R339Q	probably damaging	Het
Flt3	T	A	5: 147,356,353	E481V	probably benign	Het
Gorab	T	G	1: 163,397,136	K32T	possibly damaging	Het
Mak16	G	A	8: 31,166,177	Q93*	probably null	Het
Muc4	T	C	16: 32,755,843		probably benign	Het
Neb	A	T	2: 52,193,237	I5409N	probably benign	Het
Olfm4	C	T	14: 80,021,224	S304F	probably benign	Het
Rab11a	A	G	9: 64,725,568	S19P	probably benign	Het
Rab11fip3	T	C	17: 26,036,657	D541G	probably damaging	Het
Rnf10	T	C	5: 115,260,151	S108G	probably damaging	Het
Rps4l-ps	C	T	7: 114,927,168		noncoding transcript	Het
Shank1	A	T	7: 44,354,590	H1902L	possibly damaging	Het
Slc8a3	T	C	12: 81,315,853	Y64C	probably damaging	Het
Sorbs3	A	C	14: 70,207,617	I4S	probably damaging	Het
St18	A	G	1: 6,855,423	N935S	probably damaging	Het
Taf4b	T	C	18: 14,821,442	V525A	probably damaging	Het
Timm10b	A	G	7: 105,682,806	N828S	probably benign	Het
Ttyh1	A	T	7: 4,119,764	D4V	probably damaging	Het
Usp34	T	A	11: 23,421,257	L53Q	possibly damaging	Het
Usp5	C	G	6: 124,822,630	K318N	possibly damaging	Het
Vmn2r70	A	T	7: 85,559,579	N563K	probably damaging	Het
Xrcc5	C	A	1: 72,312,500	N76K	probably damaging	Het
Zscan25	T	C	5: 145,283,458	V21A	probably damaging	Het

Other mutations in Pask

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01366:Pask	APN	1	93310852	missense	probably benign	0.02
IGL01620:Pask	APN	1	93310122	missense	possibly damaging	0.87
IGL01959:Pask	APN	1	93334607	missense	probably benign	0.03
IGL02170:Pask	APN	1	93310884	missense	possibly damaging	0.69
IGL02499:Pask	APN	1	93321095	nonsense	probably null
IGL02670:Pask	APN	1	93310818	missense	probably damaging	1.00
IGL03066:Pask	APN	1	93330866	missense	probably benign	0.02
IGL03210:Pask	APN	1	93319992	missense	possibly damaging	0.92
R0472:Pask	UTSW	1	93320917	missense	probably benign	0.00
R0524:Pask	UTSW	1	93310834	missense	probably damaging	1.00
R0854:Pask	UTSW	1	93327400	missense	probably damaging	0.99
R0854:Pask	UTSW	1	93327412	missense	probably damaging	1.00
R0854:Pask	UTSW	1	93327434	missense	possibly damaging	0.79
R0863:Pask	UTSW	1	93314339	missense	probably damaging	1.00
R1052:Pask	UTSW	1	93330827	missense	probably benign	0.00
R1406:Pask	UTSW	1	93321651	missense	probably benign	0.00
R1406:Pask	UTSW	1	93321651	missense	probably benign	0.00
R1831:Pask	UTSW	1	93320769	splice site	probably null
R1958:Pask	UTSW	1	93321458	missense	probably benign	0.00
R2143:Pask	UTSW	1	93321297	missense	probably benign	0.00
R2144:Pask	UTSW	1	93321297	missense	probably benign	0.00
R2145:Pask	UTSW	1	93321297	missense	probably benign	0.00
R2509:Pask	UTSW	1	93330763	missense	possibly damaging	0.62
R2858:Pask	UTSW	1	93321651	missense	probably benign	0.00
R2899:Pask	UTSW	1	93334547	missense	probably damaging	1.00
R3545:Pask	UTSW	1	93317115	missense	probably damaging	1.00
R3778:Pask	UTSW	1	93327467	missense	probably damaging	1.00
R4111:Pask	UTSW	1	93310818	missense	probably damaging	1.00
R4514:Pask	UTSW	1	93322133	missense	probably benign	0.03
R4580:Pask	UTSW	1	93322108	missense	probably benign	0.36
R4718:Pask	UTSW	1	93322196	missense	possibly damaging	0.67
R4775:Pask	UTSW	1	93337524	missense	probably damaging	0.97
R5036:Pask	UTSW	1	93322079	nonsense	probably null
R5070:Pask	UTSW	1	93330874	missense	probably damaging	1.00
R5084:Pask	UTSW	1	93322097	missense	probably benign
R5151:Pask	UTSW	1	93334628	missense	probably damaging	1.00
R5196:Pask	UTSW	1	93310083	unclassified	probably benign
R5643:Pask	UTSW	1	93337343	critical splice donor site	probably null
R5739:Pask	UTSW	1	93322056	missense	probably benign
R6126:Pask	UTSW	1	93314359	missense	probably damaging	1.00
R7161:Pask	UTSW	1	93310905	missense	probably benign
R7284:Pask	UTSW	1	93320669	missense	probably benign	0.01
R7289:Pask	UTSW	1	93331587	missense	probably damaging	1.00
R8277:Pask	UTSW	1	93325363	critical splice donor site	probably null
R8303:Pask	UTSW	1	93320564	missense	probably benign	0.10
R8309:Pask	UTSW	1	93312851	nonsense	probably null
R8321:Pask	UTSW	1	93320655	missense	possibly damaging	0.85
R8476:Pask	UTSW	1	93321639	missense	probably benign	0.00
R8814:Pask	UTSW	1	93320585	missense	probably benign	0.00
R9061:Pask	UTSW	1	93325469	nonsense	probably null
R9198:Pask	UTSW	1	93337483	missense	possibly damaging	0.72
R9406:Pask	UTSW	1	93324265	missense	probably benign	0.02
R9578:Pask	UTSW	1	93335668	missense	probably benign	0.00
Z1088:Pask	UTSW	1	93316801	missense	probably damaging	1.00
Z1177:Pask	UTSW	1	93335732	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAACCCAAACTGGCTTATGTC -3'
(R):5'- CAGTTTGAAGTCAAGCGTGTGG -3'

Sequencing Primer
(F):5'- CCCAAACTGGCTTATGTCTAAATGC -3'
(R):5'- AAGTCAAGCGTGTGGAGCTCC -3'

Posted On

2015-08-18