Incidental Mutation 'R4527:Rnf10'
ID334474
Institutional Source Beutler Lab
Gene Symbol Rnf10
Ensembl Gene ENSMUSG00000041740
Gene Namering finger protein 10
Synonyms
MMRRC Submission 041768-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.671) question?
Stock #R4527 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location115241412-115272898 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115260151 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 108 (S108G)
Ref Sequence ENSEMBL: ENSMUSP00000041778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040555] [ENSMUST00000112096] [ENSMUST00000112097]
Predicted Effect probably damaging
Transcript: ENSMUST00000040555
AA Change: S108G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041778
Gene: ENSMUSG00000041740
AA Change: S108G

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
RING 225 266 1.98e-8 SMART
low complexity region 379 400 N/A INTRINSIC
low complexity region 439 461 N/A INTRINSIC
low complexity region 591 618 N/A INTRINSIC
low complexity region 660 671 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112096
AA Change: S108G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000107725
Gene: ENSMUSG00000041740
AA Change: S108G

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
RING 225 266 1.98e-8 SMART
low complexity region 379 400 N/A INTRINSIC
low complexity region 439 461 N/A INTRINSIC
low complexity region 591 618 N/A INTRINSIC
low complexity region 660 671 N/A INTRINSIC
low complexity region 782 793 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112097
AA Change: S108G

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107726
Gene: ENSMUSG00000041740
AA Change: S108G

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
RING 225 266 1.98e-8 SMART
low complexity region 379 400 N/A INTRINSIC
low complexity region 440 462 N/A INTRINSIC
low complexity region 592 619 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133276
Predicted Effect unknown
Transcript: ENSMUST00000139853
AA Change: S70G
SMART Domains Protein: ENSMUSP00000131696
Gene: ENSMUSG00000041740
AA Change: S70G

DomainStartEndE-ValueType
low complexity region 41 53 N/A INTRINSIC
low complexity region 63 77 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
RING 188 229 1.98e-8 SMART
low complexity region 342 363 N/A INTRINSIC
low complexity region 402 424 N/A INTRINSIC
low complexity region 554 581 N/A INTRINSIC
low complexity region 623 634 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202855
Meta Mutation Damage Score 0.0729 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: The protein encoding this gene is a member of the really interesting new gene finger protein family. Members of this family contain protein motifs similar to zinc finger domains and are involved in many processes that include transcriptional regulation, DNA repair and signal transduction. Expression of this gene is upregulated during neuronal differentiation of cultured cells, and inhibition of its expression impairs differentiation and cell cycle exit, providing evidence for a function in neuronal differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agfg2 A G 5: 137,684,536 V15A unknown Het
Asb3 A G 11: 31,058,933 D278G probably benign Het
Atrn T C 2: 130,973,504 I780T probably benign Het
Car2 C T 3: 14,898,005 P200L probably damaging Het
Cars A T 7: 143,565,049 M668K probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cer1 A G 4: 82,884,669 F139L possibly damaging Het
Crhr2 T A 6: 55,132,853 probably benign Het
Dnah7c G A 1: 46,532,931 E855K probably benign Het
Espn C T 4: 152,135,649 R339Q probably damaging Het
Flt3 T A 5: 147,356,353 E481V probably benign Het
Gorab T G 1: 163,397,136 K32T possibly damaging Het
Mak16 G A 8: 31,166,177 Q93* probably null Het
Muc4 T C 16: 32,755,843 probably benign Het
Neb A T 2: 52,193,237 I5409N probably benign Het
Olfm4 C T 14: 80,021,224 S304F probably benign Het
Pask A G 1: 93,320,502 F1026L probably benign Het
Rab11a A G 9: 64,725,568 S19P probably benign Het
Rab11fip3 T C 17: 26,036,657 D541G probably damaging Het
Rps4l-ps C T 7: 114,927,168 noncoding transcript Het
Shank1 A T 7: 44,354,590 H1902L possibly damaging Het
Slc8a3 T C 12: 81,315,853 Y64C probably damaging Het
Sorbs3 A C 14: 70,207,617 I4S probably damaging Het
St18 A G 1: 6,855,423 N935S probably damaging Het
Taf4b T C 18: 14,821,442 V525A probably damaging Het
Timm10b A G 7: 105,682,806 N828S probably benign Het
Ttyh1 A T 7: 4,119,764 D4V probably damaging Het
Usp34 T A 11: 23,421,257 L53Q possibly damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r70 A T 7: 85,559,579 N563K probably damaging Het
Xrcc5 C A 1: 72,312,500 N76K probably damaging Het
Zscan25 T C 5: 145,283,458 V21A probably damaging Het
Other mutations in Rnf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Rnf10 APN 5 115256983 missense probably damaging 1.00
IGL01995:Rnf10 APN 5 115251102 nonsense probably null
IGL02291:Rnf10 APN 5 115260196 missense probably damaging 1.00
IGL02751:Rnf10 APN 5 115242666 missense probably benign 0.20
IGL02897:Rnf10 APN 5 115248641 missense probably benign
IGL02968:Rnf10 APN 5 115245888 missense probably benign 0.05
IGL03008:Rnf10 APN 5 115251296 missense possibly damaging 0.92
IGL03098:Rnf10 UTSW 5 115272367 missense probably damaging 1.00
R0409:Rnf10 UTSW 5 115255447 splice site probably benign
R1083:Rnf10 UTSW 5 115260104 splice site probably benign
R1754:Rnf10 UTSW 5 115245865 missense probably damaging 0.99
R1957:Rnf10 UTSW 5 115260322 splice site probably benign
R2398:Rnf10 UTSW 5 115247273 missense probably benign 0.33
R2848:Rnf10 UTSW 5 115249112 missense probably benign
R2849:Rnf10 UTSW 5 115249112 missense probably benign
R4617:Rnf10 UTSW 5 115248703 missense probably damaging 1.00
R4673:Rnf10 UTSW 5 115251089 missense probably damaging 0.99
R4823:Rnf10 UTSW 5 115255442 critical splice acceptor site probably null
R5560:Rnf10 UTSW 5 115249998 missense probably damaging 1.00
R5805:Rnf10 UTSW 5 115244068 missense probably benign
R6192:Rnf10 UTSW 5 115257077 missense probably damaging 1.00
R7061:Rnf10 UTSW 5 115257090 missense probably damaging 0.98
R7206:Rnf10 UTSW 5 115244121 missense probably benign 0.04
R7213:Rnf10 UTSW 5 115242473 missense probably damaging 1.00
R7213:Rnf10 UTSW 5 115242474 missense probably damaging 1.00
R7429:Rnf10 UTSW 5 115248680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACACCTGCTGTCATGTC -3'
(R):5'- TTGGCCGTGTCTGGGAAAAC -3'

Sequencing Primer
(F):5'- ATGTCTCCTCCCCCAGGG -3'
(R):5'- TCCAAGCGTTACAATCGC -3'
Posted On2015-08-18