Incidental Mutation 'R4527:Usp5'
ID 334479
Institutional Source Beutler Lab
Gene Symbol Usp5
Ensembl Gene ENSMUSG00000038429
Gene Name ubiquitin specific peptidase 5 (isopeptidase T)
Synonyms Ucht
MMRRC Submission 041768-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4527 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 124815019-124829484 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 124822630 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 318 (K318N)
Ref Sequence ENSEMBL: ENSMUSP00000041299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047510] [ENSMUST00000122110] [ENSMUST00000142058] [ENSMUST00000153306]
AlphaFold P56399
Predicted Effect possibly damaging
Transcript: ENSMUST00000047510
AA Change: K318N

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000041299
Gene: ENSMUSG00000038429
AA Change: K318N

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Blast:ZnF_UBP 29 78 4e-19 BLAST
ZnF_UBP 198 253 6.47e-27 SMART
low complexity region 497 516 N/A INTRINSIC
UBA 656 694 3.12e-7 SMART
UBA 724 761 8.63e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122110
AA Change: K318N

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114000
Gene: ENSMUSG00000038429
AA Change: K318N

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Blast:ZnF_UBP 29 78 4e-19 BLAST
ZnF_UBP 198 253 6.47e-27 SMART
low complexity region 497 516 N/A INTRINSIC
UBA 633 671 3.12e-7 SMART
UBA 701 738 8.63e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131805
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141042
Predicted Effect possibly damaging
Transcript: ENSMUST00000142058
AA Change: K300N

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117439
Gene: ENSMUSG00000038429
AA Change: K300N

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Blast:ZnF_UBP 29 78 4e-20 BLAST
ZnF_UBP 180 235 6.47e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146098
Predicted Effect probably benign
Transcript: ENSMUST00000153306
SMART Domains Protein: ENSMUSP00000118200
Gene: ENSMUSG00000038429

DomainStartEndE-ValueType
Blast:ZnF_UBP 1 32 3e-7 BLAST
ZnF_UBP 152 207 6.47e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154189
Meta Mutation Damage Score 0.0822 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin (see MIM 191339)-dependent proteolysis is a complex pathway of protein metabolism implicated in such diverse cellular functions as maintenance of chromatin structure, receptor function, and degradation of abnormal proteins. A late step of the process involves disassembly of the polyubiquitin chains on degraded proteins into ubiquitin monomers. USP5 disassembles branched polyubiquitin chains by a sequential exo mechanism, starting at the proximal end of the chain (Wilkinson et al., 1995 [PubMed 7578059]).[supplied by OMIM, Mar 2010]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agfg2 A G 5: 137,684,536 V15A unknown Het
Asb3 A G 11: 31,058,933 D278G probably benign Het
Atrn T C 2: 130,973,504 I780T probably benign Het
Car2 C T 3: 14,898,005 P200L probably damaging Het
Cars A T 7: 143,565,049 M668K probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cer1 A G 4: 82,884,669 F139L possibly damaging Het
Crhr2 T A 6: 55,132,853 probably benign Het
Dnah7c G A 1: 46,532,931 E855K probably benign Het
Espn C T 4: 152,135,649 R339Q probably damaging Het
Flt3 T A 5: 147,356,353 E481V probably benign Het
Gorab T G 1: 163,397,136 K32T possibly damaging Het
Mak16 G A 8: 31,166,177 Q93* probably null Het
Muc4 T C 16: 32,755,843 probably benign Het
Neb A T 2: 52,193,237 I5409N probably benign Het
Olfm4 C T 14: 80,021,224 S304F probably benign Het
Pask A G 1: 93,320,502 F1026L probably benign Het
Rab11a A G 9: 64,725,568 S19P probably benign Het
Rab11fip3 T C 17: 26,036,657 D541G probably damaging Het
Rnf10 T C 5: 115,260,151 S108G probably damaging Het
Rps4l-ps C T 7: 114,927,168 noncoding transcript Het
Shank1 A T 7: 44,354,590 H1902L possibly damaging Het
Slc8a3 T C 12: 81,315,853 Y64C probably damaging Het
Sorbs3 A C 14: 70,207,617 I4S probably damaging Het
St18 A G 1: 6,855,423 N935S probably damaging Het
Taf4b T C 18: 14,821,442 V525A probably damaging Het
Timm10b A G 7: 105,682,806 N828S probably benign Het
Ttyh1 A T 7: 4,119,764 D4V probably damaging Het
Usp34 T A 11: 23,421,257 L53Q possibly damaging Het
Vmn2r70 A T 7: 85,559,579 N563K probably damaging Het
Xrcc5 C A 1: 72,312,500 N76K probably damaging Het
Zscan25 T C 5: 145,283,458 V21A probably damaging Het
Other mutations in Usp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Usp5 APN 6 124829353 missense probably benign 0.00
IGL00905:Usp5 APN 6 124815613 missense probably damaging 1.00
IGL01584:Usp5 APN 6 124819387 missense probably damaging 1.00
IGL01642:Usp5 APN 6 124820453 missense probably damaging 0.99
IGL01787:Usp5 APN 6 124824226 missense possibly damaging 0.95
IGL02394:Usp5 APN 6 124822709 missense probably damaging 1.00
IGL02677:Usp5 APN 6 124819426 missense probably damaging 1.00
IGL03392:Usp5 APN 6 124826387 missense probably damaging 1.00
BB004:Usp5 UTSW 6 124824229 missense probably benign 0.06
BB014:Usp5 UTSW 6 124824229 missense probably benign 0.06
R0594:Usp5 UTSW 6 124817424 missense probably damaging 0.99
R1522:Usp5 UTSW 6 124825166 missense probably benign
R1719:Usp5 UTSW 6 124823460 missense possibly damaging 0.94
R2185:Usp5 UTSW 6 124817410 missense probably damaging 0.99
R3115:Usp5 UTSW 6 124815597 missense probably damaging 1.00
R4196:Usp5 UTSW 6 124824938 missense possibly damaging 0.78
R4347:Usp5 UTSW 6 124821195 missense probably damaging 1.00
R4386:Usp5 UTSW 6 124818474 critical splice donor site probably null
R4500:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4501:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4526:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4528:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4684:Usp5 UTSW 6 124817956 missense probably damaging 1.00
R4912:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4913:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4954:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4956:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4957:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4958:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R5071:Usp5 UTSW 6 124826379 missense probably benign 0.13
R6020:Usp5 UTSW 6 124817613 unclassified probably benign
R6236:Usp5 UTSW 6 124818478 missense probably benign 0.05
R6370:Usp5 UTSW 6 124820428 missense probably benign 0.01
R7090:Usp5 UTSW 6 124829394 start codon destroyed probably null
R7317:Usp5 UTSW 6 124826318 missense probably damaging 0.98
R7447:Usp5 UTSW 6 124821114 missense probably damaging 1.00
R7572:Usp5 UTSW 6 124818007 missense probably damaging 0.99
R7598:Usp5 UTSW 6 124826379 missense possibly damaging 0.73
R7927:Usp5 UTSW 6 124824229 missense probably benign 0.06
R7931:Usp5 UTSW 6 124824446 intron probably benign
R8089:Usp5 UTSW 6 124820410 critical splice donor site probably null
R8361:Usp5 UTSW 6 124824985 missense probably damaging 1.00
R8544:Usp5 UTSW 6 124823517 missense probably damaging 1.00
R8679:Usp5 UTSW 6 124817431 missense possibly damaging 0.94
R9115:Usp5 UTSW 6 124826421 missense probably damaging 0.97
R9128:Usp5 UTSW 6 124823451 critical splice donor site probably null
R9227:Usp5 UTSW 6 124818636 missense probably damaging 1.00
R9651:Usp5 UTSW 6 124822538 missense possibly damaging 0.91
X0058:Usp5 UTSW 6 124824176 missense probably damaging 1.00
Z1177:Usp5 UTSW 6 124825148 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGCCCTCCTTAAGTAATGC -3'
(R):5'- TCGAGGATGAGTCTTAGTCCAG -3'

Sequencing Primer
(F):5'- GGCCCTCCTTAAGTAATGCTAAAATG -3'
(R):5'- TCTTAGTCCAGAGCTTAGAGACG -3'
Posted On 2015-08-18