Incidental Mutation 'R4527:Vmn2r70'
ID334482
Institutional Source Beutler Lab
Gene Symbol Vmn2r70
Ensembl Gene ENSMUSG00000090806
Gene Namevomeronasal 2, receptor 70
SynonymsEG620835
MMRRC Submission 041768-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R4527 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location85558703-85569088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85559579 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 563 (N563K)
Ref Sequence ENSEMBL: ENSMUSP00000129703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168230]
Predicted Effect probably damaging
Transcript: ENSMUST00000168230
AA Change: N563K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129703
Gene: ENSMUSG00000090806
AA Change: N563K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ANF_receptor 77 468 2.5e-28 PFAM
Pfam:NCD3G 510 562 1.5e-19 PFAM
Pfam:7tm_3 592 830 1.2e-52 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agfg2 A G 5: 137,684,536 V15A unknown Het
Asb3 A G 11: 31,058,933 D278G probably benign Het
Atrn T C 2: 130,973,504 I780T probably benign Het
Car2 C T 3: 14,898,005 P200L probably damaging Het
Cars A T 7: 143,565,049 M668K probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cer1 A G 4: 82,884,669 F139L possibly damaging Het
Crhr2 T A 6: 55,132,853 probably benign Het
Dnah7c G A 1: 46,532,931 E855K probably benign Het
Espn C T 4: 152,135,649 R339Q probably damaging Het
Flt3 T A 5: 147,356,353 E481V probably benign Het
Gorab T G 1: 163,397,136 K32T possibly damaging Het
Mak16 G A 8: 31,166,177 Q93* probably null Het
Muc4 T C 16: 32,755,843 probably benign Het
Neb A T 2: 52,193,237 I5409N probably benign Het
Olfm4 C T 14: 80,021,224 S304F probably benign Het
Pask A G 1: 93,320,502 F1026L probably benign Het
Rab11a A G 9: 64,725,568 S19P probably benign Het
Rab11fip3 T C 17: 26,036,657 D541G probably damaging Het
Rnf10 T C 5: 115,260,151 S108G probably damaging Het
Rps4l-ps C T 7: 114,927,168 noncoding transcript Het
Shank1 A T 7: 44,354,590 H1902L possibly damaging Het
Slc8a3 T C 12: 81,315,853 Y64C probably damaging Het
Sorbs3 A C 14: 70,207,617 I4S probably damaging Het
St18 A G 1: 6,855,423 N935S probably damaging Het
Taf4b T C 18: 14,821,442 V525A probably damaging Het
Timm10b A G 7: 105,682,806 N828S probably benign Het
Ttyh1 A T 7: 4,119,764 D4V probably damaging Het
Usp34 T A 11: 23,421,257 L53Q possibly damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Xrcc5 C A 1: 72,312,500 N76K probably damaging Het
Zscan25 T C 5: 145,283,458 V21A probably damaging Het
Other mutations in Vmn2r70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Vmn2r70 APN 7 85563799 missense probably benign 0.00
IGL01140:Vmn2r70 APN 7 85565171 nonsense probably null
IGL01287:Vmn2r70 APN 7 85569019 nonsense probably null
IGL01581:Vmn2r70 APN 7 85563914 splice site probably null
IGL01632:Vmn2r70 APN 7 85566072 missense probably benign 0.00
IGL01725:Vmn2r70 APN 7 85559386 missense probably damaging 1.00
IGL02244:Vmn2r70 APN 7 85565003 missense probably benign
IGL02288:Vmn2r70 APN 7 85565134 missense probably benign 0.31
IGL02313:Vmn2r70 APN 7 85565168 missense probably damaging 0.99
IGL02591:Vmn2r70 APN 7 85564945 missense probably damaging 0.96
IGL02725:Vmn2r70 APN 7 85565345 missense possibly damaging 0.46
IGL02797:Vmn2r70 APN 7 85559087 missense probably benign 0.00
R0045:Vmn2r70 UTSW 7 85566044 missense probably damaging 1.00
R0729:Vmn2r70 UTSW 7 85565904 missense probably benign 0.00
R0967:Vmn2r70 UTSW 7 85559619 missense probably damaging 0.99
R1217:Vmn2r70 UTSW 7 85559061 missense probably damaging 1.00
R1351:Vmn2r70 UTSW 7 85565054 missense probably damaging 1.00
R1387:Vmn2r70 UTSW 7 85558761 missense probably benign 0.12
R1483:Vmn2r70 UTSW 7 85559167 missense probably benign 0.04
R1796:Vmn2r70 UTSW 7 85563803 nonsense probably null
R1809:Vmn2r70 UTSW 7 85565922 missense probably benign 0.23
R2154:Vmn2r70 UTSW 7 85563715 missense possibly damaging 0.67
R2173:Vmn2r70 UTSW 7 85565082 missense probably benign
R2334:Vmn2r70 UTSW 7 85559592 missense probably benign 0.05
R2871:Vmn2r70 UTSW 7 85559019 missense probably damaging 1.00
R2871:Vmn2r70 UTSW 7 85559019 missense probably damaging 1.00
R3975:Vmn2r70 UTSW 7 85559332 missense probably benign 0.00
R4525:Vmn2r70 UTSW 7 85559579 missense probably damaging 1.00
R4535:Vmn2r70 UTSW 7 85565333 missense probably damaging 1.00
R5181:Vmn2r70 UTSW 7 85559179 missense probably damaging 0.99
R5600:Vmn2r70 UTSW 7 85563727 missense probably benign 0.07
R5641:Vmn2r70 UTSW 7 85559364 missense probably damaging 0.99
R5726:Vmn2r70 UTSW 7 85559107 missense probably damaging 1.00
R5943:Vmn2r70 UTSW 7 85565991 missense probably benign 0.09
R6166:Vmn2r70 UTSW 7 85565981 missense probably benign 0.25
R6272:Vmn2r70 UTSW 7 85558986 missense probably damaging 1.00
R6324:Vmn2r70 UTSW 7 85558879 missense probably benign 0.01
R6429:Vmn2r70 UTSW 7 85559068 missense probably damaging 1.00
R6449:Vmn2r70 UTSW 7 85564949 missense probably damaging 1.00
R6512:Vmn2r70 UTSW 7 85566097 missense probably benign
R7000:Vmn2r70 UTSW 7 85559611 missense probably damaging 0.99
R7141:Vmn2r70 UTSW 7 85558836 missense probably benign
R7153:Vmn2r70 UTSW 7 85565054 missense probably damaging 1.00
R7424:Vmn2r70 UTSW 7 85563868 missense probably damaging 1.00
R7565:Vmn2r70 UTSW 7 85565291 missense probably benign 0.35
R7567:Vmn2r70 UTSW 7 85565035 missense probably benign 0.41
R7593:Vmn2r70 UTSW 7 85566104 nonsense probably null
R7660:Vmn2r70 UTSW 7 85568922 missense probably damaging 0.99
R7806:Vmn2r70 UTSW 7 85559193 missense probably benign
R7892:Vmn2r70 UTSW 7 85559380 missense possibly damaging 0.58
R7965:Vmn2r70 UTSW 7 85561863 missense probably damaging 0.96
R8052:Vmn2r70 UTSW 7 85563715 missense probably benign
R8251:Vmn2r70 UTSW 7 85565978 nonsense probably null
Z1088:Vmn2r70 UTSW 7 85564760 missense possibly damaging 0.53
Z1176:Vmn2r70 UTSW 7 85569045 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAAAGCTGAGAGATTGGTTGTTG -3'
(R):5'- AACATGTATGGACACAGCCC -3'

Sequencing Primer
(F):5'- GGCTTTGACTATGGGAGTATCTC -3'
(R):5'- GTATGGACACAGCCCATTTTAG -3'
Posted On2015-08-18