Incidental Mutation 'R4527:Cars'
ID334485
Institutional Source Beutler Lab
Gene Symbol Cars
Ensembl Gene ENSMUSG00000010755
Gene Namecysteinyl-tRNA synthetase
SynonymsCA3
MMRRC Submission 041768-MU
Accession Numbers

Genbank: NM_013742

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4527 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location143557230-143600090 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 143565049 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 668 (M668K)
Ref Sequence ENSEMBL: ENSMUSP00000010899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010899] [ENSMUST00000105909]
Predicted Effect probably benign
Transcript: ENSMUST00000010899
AA Change: M668K

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000010899
Gene: ENSMUSG00000010755
AA Change: M668K

DomainStartEndE-ValueType
Pfam:tRNA-synt_1e 124 537 2.7e-128 PFAM
Blast:DALR_2 584 644 2e-13 BLAST
coiled coil region 728 768 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105909
AA Change: M585K

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101529
Gene: ENSMUSG00000010755
AA Change: M585K

DomainStartEndE-ValueType
Pfam:tRNA-synt_1e 41 454 2e-129 PFAM
Pfam:tRNA-synt_1g 387 465 1.2e-6 PFAM
Blast:DALR_2 501 561 1e-13 BLAST
coiled coil region 645 685 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146904
Predicted Effect probably benign
Transcript: ENSMUST00000208575
Meta Mutation Damage Score 0.2333 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class 1 aminoacyl-tRNA synthetase, cysteinyl-tRNA synthetase. Each of the twenty aminoacyl-tRNA synthetases catalyzes the aminoacylation of a specific tRNA or tRNA isoaccepting family with the cognate amino acid. This gene is one of several located near the imprinted gene domain on chromosome 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian and breast cancers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2010]
Allele List at MGI

All alleles(37) : Targeted, other(2) Gene trapped(35)

Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agfg2 A G 5: 137,684,536 V15A unknown Het
Asb3 A G 11: 31,058,933 D278G probably benign Het
Atrn T C 2: 130,973,504 I780T probably benign Het
Car2 C T 3: 14,898,005 P200L probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cer1 A G 4: 82,884,669 F139L possibly damaging Het
Crhr2 T A 6: 55,132,853 probably benign Het
Dnah7c G A 1: 46,532,931 E855K probably benign Het
Espn C T 4: 152,135,649 R339Q probably damaging Het
Flt3 T A 5: 147,356,353 E481V probably benign Het
Gorab T G 1: 163,397,136 K32T possibly damaging Het
Mak16 G A 8: 31,166,177 Q93* probably null Het
Muc4 T C 16: 32,755,843 probably benign Het
Neb A T 2: 52,193,237 I5409N probably benign Het
Olfm4 C T 14: 80,021,224 S304F probably benign Het
Pask A G 1: 93,320,502 F1026L probably benign Het
Rab11a A G 9: 64,725,568 S19P probably benign Het
Rab11fip3 T C 17: 26,036,657 D541G probably damaging Het
Rnf10 T C 5: 115,260,151 S108G probably damaging Het
Rps4l-ps C T 7: 114,927,168 noncoding transcript Het
Shank1 A T 7: 44,354,590 H1902L possibly damaging Het
Slc8a3 T C 12: 81,315,853 Y64C probably damaging Het
Sorbs3 A C 14: 70,207,617 I4S probably damaging Het
St18 A G 1: 6,855,423 N935S probably damaging Het
Taf4b T C 18: 14,821,442 V525A probably damaging Het
Timm10b A G 7: 105,682,806 N828S probably benign Het
Ttyh1 A T 7: 4,119,764 D4V probably damaging Het
Usp34 T A 11: 23,421,257 L53Q possibly damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r70 A T 7: 85,559,579 N563K probably damaging Het
Xrcc5 C A 1: 72,312,500 N76K probably damaging Het
Zscan25 T C 5: 145,283,458 V21A probably damaging Het
Other mutations in Cars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Cars APN 7 143569849 missense probably benign 0.03
IGL02192:Cars APN 7 143571588 missense probably damaging 1.00
IGL02645:Cars APN 7 143557909 missense probably damaging 0.97
IGL02807:Cars APN 7 143569472 missense possibly damaging 0.87
IGL02860:Cars APN 7 143586421 missense probably damaging 1.00
IGL03005:Cars APN 7 143559169 missense probably damaging 1.00
vroom UTSW 7 143570648 missense probably damaging 1.00
F5493:Cars UTSW 7 143569871 missense probably damaging 1.00
R0358:Cars UTSW 7 143588482 splice site probably benign
R0452:Cars UTSW 7 143592625 nonsense probably null
R0717:Cars UTSW 7 143584755 missense probably damaging 0.98
R0930:Cars UTSW 7 143570570 missense probably damaging 1.00
R1069:Cars UTSW 7 143570107 missense probably benign 0.40
R1184:Cars UTSW 7 143587139 missense probably damaging 1.00
R1503:Cars UTSW 7 143568989 missense probably benign 0.04
R1755:Cars UTSW 7 143569457 missense probably damaging 1.00
R1762:Cars UTSW 7 143592474 missense probably damaging 1.00
R1783:Cars UTSW 7 143592474 missense probably damaging 1.00
R1786:Cars UTSW 7 143592474 missense probably damaging 1.00
R1828:Cars UTSW 7 143576648 missense probably damaging 0.97
R2084:Cars UTSW 7 143587182 missense probably benign 0.03
R2132:Cars UTSW 7 143592474 missense probably damaging 1.00
R2133:Cars UTSW 7 143592474 missense probably damaging 1.00
R2397:Cars UTSW 7 143592507 missense possibly damaging 0.61
R4012:Cars UTSW 7 143559674 missense possibly damaging 0.65
R4057:Cars UTSW 7 143570648 missense probably damaging 1.00
R4082:Cars UTSW 7 143569497 missense probably damaging 1.00
R4118:Cars UTSW 7 143559647 critical splice donor site probably null
R4663:Cars UTSW 7 143575960 missense probably damaging 1.00
R4758:Cars UTSW 7 143571567 missense probably benign 0.01
R4820:Cars UTSW 7 143570564 missense probably damaging 1.00
R4921:Cars UTSW 7 143569475 missense probably damaging 1.00
R4923:Cars UTSW 7 143569850 missense probably damaging 0.97
R5512:Cars UTSW 7 143570133 missense possibly damaging 0.91
R6505:Cars UTSW 7 143565007 missense probably damaging 1.00
R7125:Cars UTSW 7 143584773 missense probably benign 0.01
R7641:Cars UTSW 7 143587103 critical splice donor site probably null
R7674:Cars UTSW 7 143587103 critical splice donor site probably null
X0021:Cars UTSW 7 143576584 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGCTGCCCTGAAAGTCCTG -3'
(R):5'- TTCAGGCTGTCCAAGAAGGG -3'

Sequencing Primer
(F):5'- CTGCCCTGAAAGTCCTGAGGAATAG -3'
(R):5'- AGATAGGGCCTGGCTGCAC -3'
Posted On2015-08-18