Mutagenetix > Incidental Mutation

Incidental Mutation 'R4527:Cars'

334485

Institutional Source

Beutler Lab

Gene Symbol

Cars

Ensembl Gene

ENSMUSG00000010755

Gene Name

cysteinyl-tRNA synthetase

Synonyms

CA3

MMRRC Submission

041768-MU

Accession Numbers

Genbank: NM_013742

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4527 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

143557230-143600090 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 143565049 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 668 (M668K)

Ref Sequence

ENSEMBL: ENSMUSP00000010899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000010899] [ENSMUST00000105909]

AlphaFold

Q9ER72

Predicted Effect

probably benign
Transcript: ENSMUST00000010899
AA Change: M668K

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000010899
Gene: ENSMUSG00000010755
AA Change: M668K

Domain	Start	End	E-Value	Type
Pfam:tRNA-synt_1e	124	537	2.7e-128	PFAM
Blast:DALR_2	584	644	2e-13	BLAST
coiled coil region	728	768	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105909
AA Change: M585K

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000101529
Gene: ENSMUSG00000010755
AA Change: M585K

Domain	Start	End	E-Value	Type
Pfam:tRNA-synt_1e	41	454	2e-129	PFAM
Pfam:tRNA-synt_1g	387	465	1.2e-6	PFAM
Blast:DALR_2	501	561	1e-13	BLAST
coiled coil region	645	685	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134753

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135032

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146462

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146904

Predicted Effect

probably benign
Transcript: ENSMUST00000208575

Meta Mutation Damage Score

0.2333

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class 1 aminoacyl-tRNA synthetase, cysteinyl-tRNA synthetase. Each of the twenty aminoacyl-tRNA synthetases catalyzes the aminoacylation of a specific tRNA or tRNA isoaccepting family with the cognate amino acid. This gene is one of several located near the imprinted gene domain on chromosome 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian and breast cancers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2010]

Allele List at MGI

All alleles(37) : Targeted, other(2) Gene trapped(35)

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agfg2	A	G	5: 137,684,536	V15A	unknown	Het
Asb3	A	G	11: 31,058,933	D278G	probably benign	Het
Atrn	T	C	2: 130,973,504	I780T	probably benign	Het
Car2	C	T	3: 14,898,005	P200L	probably damaging	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Cer1	A	G	4: 82,884,669	F139L	possibly damaging	Het
Crhr2	T	A	6: 55,132,853		probably benign	Het
Dnah7c	G	A	1: 46,532,931	E855K	probably benign	Het
Espn	C	T	4: 152,135,649	R339Q	probably damaging	Het
Flt3	T	A	5: 147,356,353	E481V	probably benign	Het
Gorab	T	G	1: 163,397,136	K32T	possibly damaging	Het
Mak16	G	A	8: 31,166,177	Q93*	probably null	Het
Muc4	T	C	16: 32,755,843		probably benign	Het
Neb	A	T	2: 52,193,237	I5409N	probably benign	Het
Olfm4	C	T	14: 80,021,224	S304F	probably benign	Het
Pask	A	G	1: 93,320,502	F1026L	probably benign	Het
Rab11a	A	G	9: 64,725,568	S19P	probably benign	Het
Rab11fip3	T	C	17: 26,036,657	D541G	probably damaging	Het
Rnf10	T	C	5: 115,260,151	S108G	probably damaging	Het
Rps4l-ps	C	T	7: 114,927,168		noncoding transcript	Het
Shank1	A	T	7: 44,354,590	H1902L	possibly damaging	Het
Slc8a3	T	C	12: 81,315,853	Y64C	probably damaging	Het
Sorbs3	A	C	14: 70,207,617	I4S	probably damaging	Het
St18	A	G	1: 6,855,423	N935S	probably damaging	Het
Taf4b	T	C	18: 14,821,442	V525A	probably damaging	Het
Timm10b	A	G	7: 105,682,806	N828S	probably benign	Het
Ttyh1	A	T	7: 4,119,764	D4V	probably damaging	Het
Usp34	T	A	11: 23,421,257	L53Q	possibly damaging	Het
Usp5	C	G	6: 124,822,630	K318N	possibly damaging	Het
Vmn2r70	A	T	7: 85,559,579	N563K	probably damaging	Het
Xrcc5	C	A	1: 72,312,500	N76K	probably damaging	Het
Zscan25	T	C	5: 145,283,458	V21A	probably damaging	Het

Other mutations in Cars

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01155:Cars	APN	7	143569849	missense	probably benign	0.03
IGL02192:Cars	APN	7	143571588	missense	probably damaging	1.00
IGL02645:Cars	APN	7	143557909	missense	probably damaging	0.97
IGL02807:Cars	APN	7	143569472	missense	possibly damaging	0.87
IGL02860:Cars	APN	7	143586421	missense	probably damaging	1.00
IGL03005:Cars	APN	7	143559169	missense	probably damaging	1.00
Vroom	UTSW	7	143570648	missense	probably damaging	1.00
Zoom	UTSW	7	143592625	nonsense	probably null
BB001:Cars	UTSW	7	143569871	missense	possibly damaging	0.88
BB011:Cars	UTSW	7	143569871	missense	possibly damaging	0.88
F5493:Cars	UTSW	7	143569871	missense	probably damaging	1.00
R0358:Cars	UTSW	7	143588482	splice site	probably benign
R0452:Cars	UTSW	7	143592625	nonsense	probably null
R0717:Cars	UTSW	7	143584755	missense	probably damaging	0.98
R0930:Cars	UTSW	7	143570570	missense	probably damaging	1.00
R1069:Cars	UTSW	7	143570107	missense	probably benign	0.40
R1184:Cars	UTSW	7	143587139	missense	probably damaging	1.00
R1503:Cars	UTSW	7	143568989	missense	probably benign	0.04
R1755:Cars	UTSW	7	143569457	missense	probably damaging	1.00
R1762:Cars	UTSW	7	143592474	missense	probably damaging	1.00
R1783:Cars	UTSW	7	143592474	missense	probably damaging	1.00
R1786:Cars	UTSW	7	143592474	missense	probably damaging	1.00
R1828:Cars	UTSW	7	143576648	missense	probably damaging	0.97
R2084:Cars	UTSW	7	143587182	missense	probably benign	0.03
R2132:Cars	UTSW	7	143592474	missense	probably damaging	1.00
R2133:Cars	UTSW	7	143592474	missense	probably damaging	1.00
R2397:Cars	UTSW	7	143592507	missense	possibly damaging	0.61
R4012:Cars	UTSW	7	143559674	missense	possibly damaging	0.65
R4057:Cars	UTSW	7	143570648	missense	probably damaging	1.00
R4082:Cars	UTSW	7	143569497	missense	probably damaging	1.00
R4118:Cars	UTSW	7	143559647	critical splice donor site	probably null
R4663:Cars	UTSW	7	143575960	missense	probably damaging	1.00
R4758:Cars	UTSW	7	143571567	missense	probably benign	0.01
R4820:Cars	UTSW	7	143570564	missense	probably damaging	1.00
R4921:Cars	UTSW	7	143569475	missense	probably damaging	1.00
R4923:Cars	UTSW	7	143569850	missense	probably damaging	0.97
R5512:Cars	UTSW	7	143570133	missense	possibly damaging	0.91
R6505:Cars	UTSW	7	143565007	missense	probably damaging	1.00
R7125:Cars	UTSW	7	143584773	missense	probably benign	0.01
R7641:Cars	UTSW	7	143587103	critical splice donor site	probably null
R7674:Cars	UTSW	7	143587103	critical splice donor site	probably null
R7812:Cars	UTSW	7	143570047	missense	probably damaging	1.00
R7924:Cars	UTSW	7	143569871	missense	possibly damaging	0.88
R8260:Cars	UTSW	7	143585709	missense	probably benign
R8447:Cars	UTSW	7	143570029	missense	possibly damaging	0.67
R8905:Cars	UTSW	7	143586459	missense	probably damaging	1.00
R9200:Cars	UTSW	7	143575917	critical splice donor site	probably null
R9240:Cars	UTSW	7	143584796	missense	probably benign	0.01
R9441:Cars	UTSW	7	143569448	missense	probably benign	0.00
R9566:Cars	UTSW	7	143559647	critical splice donor site	probably null
R9603:Cars	UTSW	7	143559192	missense	possibly damaging	0.83
X0021:Cars	UTSW	7	143576584	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ATGCTGCCCTGAAAGTCCTG -3'
(R):5'- TTCAGGCTGTCCAAGAAGGG -3'

Sequencing Primer
(F):5'- CTGCCCTGAAAGTCCTGAGGAATAG -3'
(R):5'- AGATAGGGCCTGGCTGCAC -3'

Posted On

2015-08-18