Mutagenetix > Incidental Mutation

Incidental Mutation 'R4527:Rab11fip3'

334495

Institutional Source

Beutler Lab

Gene Symbol

Rab11fip3

Ensembl Gene

ENSMUSG00000037098

Gene Name

RAB11 family interacting protein 3 (class II)

Synonyms

D030060O14Rik, Rab11-FIP3

MMRRC Submission

041768-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4527 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25989036-26069409 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 26036657 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 541 (D541G)

Ref Sequence

ENSEMBL: ENSMUSP00000113521 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000120691] [ENSMUST00000122103]

AlphaFold

Q8CHD8

Predicted Effect

probably damaging
Transcript: ENSMUST00000120691
AA Change: D541G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000112875
Gene: ENSMUSG00000037098
AA Change: D541G

Domain	Start	End	E-Value	Type
internal_repeat_1	29	130	3.12e-31	PROSPERO
internal_repeat_1	144	294	3.12e-31	PROSPERO
EFh	500	528	3.03e-1	SMART
EFh	532	560	3.86e1	SMART
low complexity region	739	751	N/A	INTRINSIC
low complexity region	916	936	N/A	INTRINSIC
Blast:BRLZ	938	988	2e-11	BLAST
Pfam:RBD-FIP	1007	1047	4.7e-18	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000122103
AA Change: D541G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113521
Gene: ENSMUSG00000037098
AA Change: D541G

Domain	Start	End	E-Value	Type
internal_repeat_1	29	130	2.03e-32	PROSPERO
internal_repeat_1	144	294	2.03e-32	PROSPERO
EFh	500	528	3.03e-1	SMART
EFh	532	560	3.86e1	SMART
low complexity region	784	796	N/A	INTRINSIC
low complexity region	961	981	N/A	INTRINSIC
Blast:BRLZ	983	1033	2e-11	BLAST
Pfam:RBD-FIP	1052	1092	4.9e-18	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126306

Meta Mutation Damage Score

0.6853

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins of the large Rab GTPase family (see RAB1A; MIM 179508) have regulatory roles in the formation, targeting, and fusion of intracellular transport vesicles. RAB11FIP3 is one of many proteins that interact with and regulate Rab GTPases (Hales et al., 2001 [PubMed 11495908]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agfg2	A	G	5: 137,684,536	V15A	unknown	Het
Asb3	A	G	11: 31,058,933	D278G	probably benign	Het
Atrn	T	C	2: 130,973,504	I780T	probably benign	Het
Car2	C	T	3: 14,898,005	P200L	probably damaging	Het
Cars	A	T	7: 143,565,049	M668K	probably benign	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Cer1	A	G	4: 82,884,669	F139L	possibly damaging	Het
Crhr2	T	A	6: 55,132,853		probably benign	Het
Dnah7c	G	A	1: 46,532,931	E855K	probably benign	Het
Espn	C	T	4: 152,135,649	R339Q	probably damaging	Het
Flt3	T	A	5: 147,356,353	E481V	probably benign	Het
Gorab	T	G	1: 163,397,136	K32T	possibly damaging	Het
Mak16	G	A	8: 31,166,177	Q93*	probably null	Het
Muc4	T	C	16: 32,755,843		probably benign	Het
Neb	A	T	2: 52,193,237	I5409N	probably benign	Het
Olfm4	C	T	14: 80,021,224	S304F	probably benign	Het
Pask	A	G	1: 93,320,502	F1026L	probably benign	Het
Rab11a	A	G	9: 64,725,568	S19P	probably benign	Het
Rnf10	T	C	5: 115,260,151	S108G	probably damaging	Het
Rps4l-ps	C	T	7: 114,927,168		noncoding transcript	Het
Shank1	A	T	7: 44,354,590	H1902L	possibly damaging	Het
Slc8a3	T	C	12: 81,315,853	Y64C	probably damaging	Het
Sorbs3	A	C	14: 70,207,617	I4S	probably damaging	Het
St18	A	G	1: 6,855,423	N935S	probably damaging	Het
Taf4b	T	C	18: 14,821,442	V525A	probably damaging	Het
Timm10b	A	G	7: 105,682,806	N828S	probably benign	Het
Ttyh1	A	T	7: 4,119,764	D4V	probably damaging	Het
Usp34	T	A	11: 23,421,257	L53Q	possibly damaging	Het
Usp5	C	G	6: 124,822,630	K318N	possibly damaging	Het
Vmn2r70	A	T	7: 85,559,579	N563K	probably damaging	Het
Xrcc5	C	A	1: 72,312,500	N76K	probably damaging	Het
Zscan25	T	C	5: 145,283,458	V21A	probably damaging	Het

Other mutations in Rab11fip3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Rab11fip3	APN	17	25991809	splice site	probably benign
IGL00420:Rab11fip3	APN	17	26067625	missense	probably benign	0.20
IGL01291:Rab11fip3	APN	17	26016113	missense	probably damaging	0.99
IGL01473:Rab11fip3	APN	17	26068735	missense	possibly damaging	0.53
IGL01687:Rab11fip3	APN	17	26067982	missense	probably damaging	0.97
IGL01764:Rab11fip3	APN	17	26068693	missense	probably benign	0.02
IGL01977:Rab11fip3	APN	17	26068003	missense	possibly damaging	0.72
IGL02140:Rab11fip3	APN	17	26067892	missense	probably benign	0.33
IGL02434:Rab11fip3	APN	17	26068835	missense	possibly damaging	0.85
IGL02549:Rab11fip3	APN	17	25994320	missense	probably damaging	0.96
IGL02889:Rab11fip3	APN	17	26067679	missense	possibly damaging	0.84
IGL02953:Rab11fip3	APN	17	26067679	missense	possibly damaging	0.84
ANU05:Rab11fip3	UTSW	17	26016113	missense	probably damaging	0.99
R0193:Rab11fip3	UTSW	17	25990999	missense	probably damaging	0.99
R0388:Rab11fip3	UTSW	17	26069072	missense	probably benign	0.33
R0543:Rab11fip3	UTSW	17	25994225	missense	probably damaging	1.00
R0678:Rab11fip3	UTSW	17	26068847	missense	probably benign	0.00
R1283:Rab11fip3	UTSW	17	26004554	missense	probably damaging	1.00
R1473:Rab11fip3	UTSW	17	25991322	missense	probably damaging	1.00
R1625:Rab11fip3	UTSW	17	26068891	missense	possibly damaging	0.72
R1973:Rab11fip3	UTSW	17	26024391	missense	probably damaging	0.97
R2160:Rab11fip3	UTSW	17	26069054	missense	probably benign	0.33
R2197:Rab11fip3	UTSW	17	26068178	missense	probably benign
R2382:Rab11fip3	UTSW	17	25990867	nonsense	probably null
R3028:Rab11fip3	UTSW	17	26015942	critical splice donor site	probably null
R3797:Rab11fip3	UTSW	17	26068526	missense	possibly damaging	0.73
R4012:Rab11fip3	UTSW	17	26068028	frame shift	probably null
R4064:Rab11fip3	UTSW	17	26024394	missense	probably damaging	0.97
R4478:Rab11fip3	UTSW	17	26016083	missense	probably damaging	1.00
R4565:Rab11fip3	UTSW	17	26068706	missense	possibly damaging	0.73
R5048:Rab11fip3	UTSW	17	26067580	critical splice donor site	probably null
R5138:Rab11fip3	UTSW	17	25991026	missense	probably benign	0.32
R5317:Rab11fip3	UTSW	17	26068078	missense	possibly damaging	0.72
R5453:Rab11fip3	UTSW	17	25992581	critical splice donor site	probably null
R5495:Rab11fip3	UTSW	17	26016143	missense	probably damaging	0.99
R5525:Rab11fip3	UTSW	17	25991295	missense	probably damaging	1.00
R5654:Rab11fip3	UTSW	17	26016064	missense	probably damaging	1.00
R5716:Rab11fip3	UTSW	17	26036664	missense	probably damaging	1.00
R5818:Rab11fip3	UTSW	17	26016116	missense	probably damaging	1.00
R6044:Rab11fip3	UTSW	17	26067869	missense	possibly damaging	0.93
R6716:Rab11fip3	UTSW	17	25991057	missense	probably damaging	1.00
R6785:Rab11fip3	UTSW	17	25991718	missense	probably damaging	0.99
R7161:Rab11fip3	UTSW	17	26069090	missense	probably benign	0.09
R7390:Rab11fip3	UTSW	17	26068152	missense	possibly damaging	0.81
R7447:Rab11fip3	UTSW	17	26068874	missense	possibly damaging	0.66
R7836:Rab11fip3	UTSW	17	26068258	missense	possibly damaging	0.82
R7981:Rab11fip3	UTSW	17	25997989	missense	probably damaging	0.98
R8008:Rab11fip3	UTSW	17	26067982	missense	probably damaging	0.97
R8887:Rab11fip3	UTSW	17	26067953	missense	possibly damaging	0.83
R8962:Rab11fip3	UTSW	17	26012033	missense	probably damaging	1.00
R9250:Rab11fip3	UTSW	17	26018245	missense	unknown
R9329:Rab11fip3	UTSW	17	26012058	missense	probably benign	0.15
R9506:Rab11fip3	UTSW	17	25994276	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACCAGATGCTTTGGGAATCC -3'
(R):5'- TGGTCGGAGGTCTCAATAGC -3'

Sequencing Primer
(F):5'- TGGATCTCTGTGAGCTCAAACCAG -3'
(R):5'- CAATAGCTCTTGAGCTCTGAACTGTG -3'

Posted On

2015-08-18