Incidental Mutation 'R4513:Got1l1'
ID334513
Institutional Source Beutler Lab
Gene Symbol Got1l1
Ensembl Gene ENSMUSG00000039720
Gene Nameglutamic-oxaloacetic transaminase 1-like 1
Synonyms
MMRRC Submission 041759-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R4513 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location27197459-27223828 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 27198485 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 279 (M279I)
Ref Sequence ENSEMBL: ENSMUSP00000041337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038174] [ENSMUST00000209299]
Predicted Effect probably benign
Transcript: ENSMUST00000038174
AA Change: M279I

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000041337
Gene: ENSMUSG00000039720
AA Change: M279I

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 32 395 1.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209281
Predicted Effect probably benign
Transcript: ENSMUST00000209299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211002
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik G T 8: 45,968,138 T116K probably damaging Het
Adgre1 A G 17: 57,410,947 I320V probably benign Het
Akap6 T C 12: 52,796,004 V45A probably benign Het
Ankrd28 A T 14: 31,743,285 S312T probably damaging Het
Cenpn A G 8: 116,933,396 Y68C probably damaging Het
Cntn3 A T 6: 102,168,982 I966N probably benign Het
D630003M21Rik T C 2: 158,204,802 T752A probably benign Het
Dmxl2 A C 9: 54,419,884 S952R probably null Het
Dopey1 G A 9: 86,520,559 E1271K probably benign Het
Fgfr3 A G 5: 33,723,116 probably benign Het
Gm10110 A G 14: 89,897,715 noncoding transcript Het
Gm13089 T C 4: 143,698,148 M242V probably benign Het
Guf1 T C 5: 69,561,662 V230A probably benign Het
Hsd17b14 C T 7: 45,562,915 L124F probably benign Het
Id3 G T 4: 136,144,358 probably benign Het
Itga8 T C 2: 12,182,736 S711G probably benign Het
Lgr4 T C 2: 110,012,016 M782T possibly damaging Het
Lsm12 T C 11: 102,167,083 probably null Het
Map1b T A 13: 99,444,233 D117V probably damaging Het
Map3k11 A G 19: 5,702,210 T807A probably damaging Het
Mapk14 T C 17: 28,724,824 F129S probably damaging Het
Mapkbp1 T A 2: 120,023,693 I1257N possibly damaging Het
Mcm3 A G 1: 20,810,232 Y459H probably damaging Het
Mkln1 T C 6: 31,433,158 probably benign Het
Msh5 A T 17: 35,030,688 I627N possibly damaging Het
Nfkbiz T C 16: 55,816,841 H488R probably benign Het
Nrg1 G T 8: 32,477,077 probably benign Het
Olfr1477 A T 19: 13,502,622 Y93F probably benign Het
Olfr348 A G 2: 36,786,770 M82V probably benign Het
Olfr574 T C 7: 102,948,738 L81P probably damaging Het
Olfr635 T C 7: 103,979,441 V89A probably benign Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Plekhg4 T A 8: 105,380,402 C910S probably damaging Het
Ppp1r18 A G 17: 35,868,304 E357G probably damaging Het
Rbm11 T C 16: 75,596,587 F57S probably damaging Het
Sbp G A 17: 23,945,312 G183D probably benign Het
Skint5 A G 4: 113,742,185 V719A unknown Het
Slc16a7 T G 10: 125,233,439 probably null Het
Slc29a1 A C 17: 45,589,066 Y232* probably null Het
Slc7a8 C G 14: 54,735,790 G240A possibly damaging Het
Spanxn4 A T 12: 62,688,100 noncoding transcript Het
Spata31d1d T C 13: 59,728,554 Q389R probably benign Het
Srgap1 A G 10: 121,870,326 probably null Het
St6gal2 A T 17: 55,483,017 N351Y probably benign Het
Tle2 A G 10: 81,587,560 D491G probably damaging Het
Tmem33 T C 5: 67,286,125 V215A probably benign Het
Trav6-3 A G 14: 53,430,091 T7A probably benign Het
Ube2q2 C A 9: 55,149,800 P56T probably benign Het
Unc79 T C 12: 103,021,760 V208A probably damaging Het
Xkr7 T C 2: 153,054,633 I469T probably benign Het
Other mutations in Got1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Got1l1 APN 8 27197991 missense probably damaging 1.00
IGL02094:Got1l1 APN 8 27199845 missense probably benign 0.10
IGL03155:Got1l1 APN 8 27199332 missense probably damaging 1.00
IGL03395:Got1l1 APN 8 27200857 missense probably benign 0.00
R0026:Got1l1 UTSW 8 27200248 missense probably benign 0.00
R1086:Got1l1 UTSW 8 27197979 missense probably damaging 1.00
R1403:Got1l1 UTSW 8 27200717 splice site probably null
R1403:Got1l1 UTSW 8 27200717 splice site probably null
R2349:Got1l1 UTSW 8 27197931 missense probably benign 0.09
R3413:Got1l1 UTSW 8 27199836 critical splice donor site probably null
R4514:Got1l1 UTSW 8 27198485 missense probably benign 0.27
R5686:Got1l1 UTSW 8 27198059 missense probably damaging 1.00
R5979:Got1l1 UTSW 8 27197923 splice site probably null
R6023:Got1l1 UTSW 8 27199904 nonsense probably null
R6229:Got1l1 UTSW 8 27198436 splice site probably null
R7635:Got1l1 UTSW 8 27197934 missense probably damaging 1.00
R8101:Got1l1 UTSW 8 27200302 missense possibly damaging 0.68
R8104:Got1l1 UTSW 8 27197591 missense probably damaging 1.00
R8298:Got1l1 UTSW 8 27198558 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CGTGTGTTAAAGGCTGAATCAC -3'
(R):5'- TGGTGGCTCCGTAGTTTAAC -3'

Sequencing Primer
(F):5'- GGCTGAATCACTATTGAATGTCTGAG -3'
(R):5'- AACCCTTTCTCTTCAAGGTCAGAGG -3'
Posted On2015-08-18