Incidental Mutation 'R4513:Cenpn'
ID334517
Institutional Source Beutler Lab
Gene Symbol Cenpn
Ensembl Gene ENSMUSG00000031756
Gene Namecentromere protein N
Synonyms2610510J17Rik
MMRRC Submission 041759-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R4513 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location116921730-116941507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116933396 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 68 (Y68C)
Ref Sequence ENSEMBL: ENSMUSP00000148413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034205] [ENSMUST00000212263] [ENSMUST00000212775]
Predicted Effect probably damaging
Transcript: ENSMUST00000034205
AA Change: Y155C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034205
Gene: ENSMUSG00000031756
AA Change: Y155C

DomainStartEndE-ValueType
Pfam:CENP-N 3 337 3.4e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212184
Predicted Effect probably damaging
Transcript: ENSMUST00000212263
AA Change: Y68C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000212775
Meta Mutation Damage Score 0.8846 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms part of the nucleosome-associated complex and is important for kinetochore assembly. It is bound to kinetochores during S phase and G2 and recruits other proteins to the centromere. Pseudogenes of this gene are located on chromosome 2. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik G T 8: 45,968,138 T116K probably damaging Het
Adgre1 A G 17: 57,410,947 I320V probably benign Het
Akap6 T C 12: 52,796,004 V45A probably benign Het
Ankrd28 A T 14: 31,743,285 S312T probably damaging Het
Cntn3 A T 6: 102,168,982 I966N probably benign Het
D630003M21Rik T C 2: 158,204,802 T752A probably benign Het
Dmxl2 A C 9: 54,419,884 S952R probably null Het
Dopey1 G A 9: 86,520,559 E1271K probably benign Het
Fgfr3 A G 5: 33,723,116 probably benign Het
Gm10110 A G 14: 89,897,715 noncoding transcript Het
Gm13089 T C 4: 143,698,148 M242V probably benign Het
Got1l1 C T 8: 27,198,485 M279I probably benign Het
Guf1 T C 5: 69,561,662 V230A probably benign Het
Hsd17b14 C T 7: 45,562,915 L124F probably benign Het
Id3 G T 4: 136,144,358 probably benign Het
Itga8 T C 2: 12,182,736 S711G probably benign Het
Lgr4 T C 2: 110,012,016 M782T possibly damaging Het
Lsm12 T C 11: 102,167,083 probably null Het
Map1b T A 13: 99,444,233 D117V probably damaging Het
Map3k11 A G 19: 5,702,210 T807A probably damaging Het
Mapk14 T C 17: 28,724,824 F129S probably damaging Het
Mapkbp1 T A 2: 120,023,693 I1257N possibly damaging Het
Mcm3 A G 1: 20,810,232 Y459H probably damaging Het
Mkln1 T C 6: 31,433,158 probably benign Het
Msh5 A T 17: 35,030,688 I627N possibly damaging Het
Nfkbiz T C 16: 55,816,841 H488R probably benign Het
Nrg1 G T 8: 32,477,077 probably benign Het
Olfr1477 A T 19: 13,502,622 Y93F probably benign Het
Olfr348 A G 2: 36,786,770 M82V probably benign Het
Olfr574 T C 7: 102,948,738 L81P probably damaging Het
Olfr635 T C 7: 103,979,441 V89A probably benign Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Plekhg4 T A 8: 105,380,402 C910S probably damaging Het
Ppp1r18 A G 17: 35,868,304 E357G probably damaging Het
Rbm11 T C 16: 75,596,587 F57S probably damaging Het
Sbp G A 17: 23,945,312 G183D probably benign Het
Skint5 A G 4: 113,742,185 V719A unknown Het
Slc16a7 T G 10: 125,233,439 probably null Het
Slc29a1 A C 17: 45,589,066 Y232* probably null Het
Slc7a8 C G 14: 54,735,790 G240A possibly damaging Het
Spanxn4 A T 12: 62,688,100 noncoding transcript Het
Spata31d1d T C 13: 59,728,554 Q389R probably benign Het
Srgap1 A G 10: 121,870,326 probably null Het
St6gal2 A T 17: 55,483,017 N351Y probably benign Het
Tle2 A G 10: 81,587,560 D491G probably damaging Het
Tmem33 T C 5: 67,286,125 V215A probably benign Het
Trav6-3 A G 14: 53,430,091 T7A probably benign Het
Ube2q2 C A 9: 55,149,800 P56T probably benign Het
Unc79 T C 12: 103,021,760 V208A probably damaging Het
Xkr7 T C 2: 153,054,633 I469T probably benign Het
Other mutations in Cenpn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Cenpn APN 8 116928587 splice site probably null
IGL02084:Cenpn APN 8 116940895 missense probably damaging 1.00
R0791:Cenpn UTSW 8 116940820 splice site probably benign
R0843:Cenpn UTSW 8 116933306 missense probably benign 0.09
R1166:Cenpn UTSW 8 116926207 missense probably damaging 1.00
R1650:Cenpn UTSW 8 116934759 missense probably damaging 1.00
R2132:Cenpn UTSW 8 116934797 critical splice donor site probably null
R4512:Cenpn UTSW 8 116933396 missense probably damaging 1.00
R4514:Cenpn UTSW 8 116933396 missense probably damaging 1.00
R4865:Cenpn UTSW 8 116934773 missense probably damaging 1.00
R5969:Cenpn UTSW 8 116940537 missense probably damaging 1.00
R6518:Cenpn UTSW 8 116937165 missense possibly damaging 0.88
R6795:Cenpn UTSW 8 116926148 missense probably benign 0.02
R7143:Cenpn UTSW 8 116937227 missense probably benign 0.00
R7556:Cenpn UTSW 8 116937269 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGTGCCCACAATGCATG -3'
(R):5'- TCTTCTGTCACATAGCCGACG -3'

Sequencing Primer
(F):5'- AACATTGATTGTGTCTCAGATGCCC -3'
(R):5'- TAGCCGACGGAGAAACGCTC -3'
Posted On2015-08-18