Incidental Mutation 'R4513:Slc16a7'
ID 334523
Institutional Source Beutler Lab
Gene Symbol Slc16a7
Ensembl Gene ENSMUSG00000020102
Gene Name solute carrier family 16 (monocarboxylic acid transporters), member 7
Synonyms 4921534N07Rik, MCT2
MMRRC Submission 041759-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R4513 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 125219270-125389465 bp(-) (GRCm38)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) T to G at 125233439 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063318] [ENSMUST00000105257] [ENSMUST00000105257] [ENSMUST00000210780] [ENSMUST00000211781] [ENSMUST00000211781]
AlphaFold O70451
Predicted Effect probably null
Transcript: ENSMUST00000063318
SMART Domains Protein: ENSMUSP00000065433
Gene: ENSMUSG00000020102

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:MFS_1 22 389 2e-37 PFAM
transmembrane domain 404 426 N/A INTRINSIC
coiled coil region 436 463 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105257
SMART Domains Protein: ENSMUSP00000100892
Gene: ENSMUSG00000020102

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:MFS_1 22 389 6e-37 PFAM
transmembrane domain 404 426 N/A INTRINSIC
coiled coil region 436 463 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105257
SMART Domains Protein: ENSMUSP00000100892
Gene: ENSMUSG00000020102

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:MFS_1 22 389 6e-37 PFAM
transmembrane domain 404 426 N/A INTRINSIC
coiled coil region 436 463 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000210780
Predicted Effect probably null
Transcript: ENSMUST00000211781
Predicted Effect probably null
Transcript: ENSMUST00000211781
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the monocarboxylate transporter family. Members in this family transport metabolites, such as lactate, pyruvate, and ketone bodies. The protein encoded by this gene catalyzes the proton-linked transport of monocarboxylates and has the highest affinity for pyruvate. This protein has been reported to be more highly expressed in prostate and colorectal cancer specimens when compared to control specimens. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik G T 8: 45,968,138 T116K probably damaging Het
Adgre1 A G 17: 57,410,947 I320V probably benign Het
Akap6 T C 12: 52,796,004 V45A probably benign Het
Ankrd28 A T 14: 31,743,285 S312T probably damaging Het
Cenpn A G 8: 116,933,396 Y68C probably damaging Het
Cntn3 A T 6: 102,168,982 I966N probably benign Het
D630003M21Rik T C 2: 158,204,802 T752A probably benign Het
Dmxl2 A C 9: 54,419,884 S952R probably null Het
Dopey1 G A 9: 86,520,559 E1271K probably benign Het
Fgfr3 A G 5: 33,723,116 probably benign Het
Gm10110 A G 14: 89,897,715 noncoding transcript Het
Gm13089 T C 4: 143,698,148 M242V probably benign Het
Got1l1 C T 8: 27,198,485 M279I probably benign Het
Guf1 T C 5: 69,561,662 V230A probably benign Het
Hsd17b14 C T 7: 45,562,915 L124F probably benign Het
Id3 G T 4: 136,144,358 probably benign Het
Itga8 T C 2: 12,182,736 S711G probably benign Het
Lgr4 T C 2: 110,012,016 M782T possibly damaging Het
Lsm12 T C 11: 102,167,083 probably null Het
Map1b T A 13: 99,444,233 D117V probably damaging Het
Map3k11 A G 19: 5,702,210 T807A probably damaging Het
Mapk14 T C 17: 28,724,824 F129S probably damaging Het
Mapkbp1 T A 2: 120,023,693 I1257N possibly damaging Het
Mcm3 A G 1: 20,810,232 Y459H probably damaging Het
Mkln1 T C 6: 31,433,158 probably benign Het
Msh5 A T 17: 35,030,688 I627N possibly damaging Het
Nfkbiz T C 16: 55,816,841 H488R probably benign Het
Nrg1 G T 8: 32,477,077 probably benign Het
Olfr1477 A T 19: 13,502,622 Y93F probably benign Het
Olfr348 A G 2: 36,786,770 M82V probably benign Het
Olfr574 T C 7: 102,948,738 L81P probably damaging Het
Olfr635 T C 7: 103,979,441 V89A probably benign Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Plekhg4 T A 8: 105,380,402 C910S probably damaging Het
Ppp1r18 A G 17: 35,868,304 E357G probably damaging Het
Rbm11 T C 16: 75,596,587 F57S probably damaging Het
Sbp G A 17: 23,945,312 G183D probably benign Het
Skint5 A G 4: 113,742,185 V719A unknown Het
Slc29a1 A C 17: 45,589,066 Y232* probably null Het
Slc7a8 C G 14: 54,735,790 G240A possibly damaging Het
Spanxn4 A T 12: 62,688,100 noncoding transcript Het
Spata31d1d T C 13: 59,728,554 Q389R probably benign Het
Srgap1 A G 10: 121,870,326 probably null Het
St6gal2 A T 17: 55,483,017 N351Y probably benign Het
Tle2 A G 10: 81,587,560 D491G probably damaging Het
Tmem33 T C 5: 67,286,125 V215A probably benign Het
Trav6-3 A G 14: 53,430,091 T7A probably benign Het
Ube2q2 C A 9: 55,149,800 P56T probably benign Het
Unc79 T C 12: 103,021,760 V208A probably damaging Het
Xkr7 T C 2: 153,054,633 I469T probably benign Het
Other mutations in Slc16a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Slc16a7 APN 10 125230934 missense probably benign 0.16
IGL02228:Slc16a7 APN 10 125230798 missense probably damaging 1.00
IGL02500:Slc16a7 APN 10 125230933 missense probably damaging 1.00
IGL03277:Slc16a7 APN 10 125230691 missense probably benign 0.00
R0044:Slc16a7 UTSW 10 125228082 missense probably benign 0.01
R0076:Slc16a7 UTSW 10 125228070 missense probably benign 0.34
R0285:Slc16a7 UTSW 10 125294631 missense probably benign 0.22
R0546:Slc16a7 UTSW 10 125230873 missense probably benign 0.02
R0898:Slc16a7 UTSW 10 125233501 missense possibly damaging 0.46
R1123:Slc16a7 UTSW 10 125231147 missense probably benign 0.00
R1173:Slc16a7 UTSW 10 125231372 missense possibly damaging 0.82
R1459:Slc16a7 UTSW 10 125230620 nonsense probably null
R1554:Slc16a7 UTSW 10 125230922 missense possibly damaging 0.70
R1838:Slc16a7 UTSW 10 125231198 missense probably damaging 1.00
R3545:Slc16a7 UTSW 10 125294700 nonsense probably null
R3546:Slc16a7 UTSW 10 125294700 nonsense probably null
R3547:Slc16a7 UTSW 10 125294700 nonsense probably null
R3934:Slc16a7 UTSW 10 125230843 missense probably damaging 1.00
R3935:Slc16a7 UTSW 10 125230843 missense probably damaging 1.00
R4499:Slc16a7 UTSW 10 125228187 missense probably damaging 1.00
R4512:Slc16a7 UTSW 10 125233439 splice site probably null
R4514:Slc16a7 UTSW 10 125233439 splice site probably null
R5157:Slc16a7 UTSW 10 125233464 nonsense probably null
R5247:Slc16a7 UTSW 10 125231314 missense probably damaging 1.00
R5385:Slc16a7 UTSW 10 125294604 missense possibly damaging 0.85
R6198:Slc16a7 UTSW 10 125228215 missense probably benign
R6263:Slc16a7 UTSW 10 125294639 missense probably benign 0.16
R6430:Slc16a7 UTSW 10 125231018 missense probably damaging 0.97
R7450:Slc16a7 UTSW 10 125228051 missense probably benign 0.00
R7680:Slc16a7 UTSW 10 125230936 missense probably benign 0.19
R8125:Slc16a7 UTSW 10 125328333 critical splice donor site probably null
R9133:Slc16a7 UTSW 10 125230667 missense probably benign 0.00
R9301:Slc16a7 UTSW 10 125231011 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCAGGATGACACATGCAAAAC -3'
(R):5'- ACATGTGCACTGATCTCTTTTG -3'

Sequencing Primer
(F):5'- TGACACATGCAAAACTGTATGG -3'
(R):5'- GCACTGATCTCTTTTGATCACTGAAC -3'
Posted On 2015-08-18