Incidental Mutation 'R4513:Akap6'
ID 334526
Institutional Source Beutler Lab
Gene Symbol Akap6
Ensembl Gene ENSMUSG00000061603
Gene Name A kinase (PRKA) anchor protein 6
Synonyms
MMRRC Submission 041759-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.843) question?
Stock # R4513 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 52699383-53155599 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 52796004 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 45 (V45A)
Ref Sequence ENSEMBL: ENSMUSP00000093406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095737] [ENSMUST00000219786]
AlphaFold E9Q9K8
Predicted Effect probably benign
Transcript: ENSMUST00000095737
AA Change: V45A

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000093406
Gene: ENSMUSG00000061603
AA Change: V45A

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
Blast:SPEC 66 168 2e-50 BLAST
low complexity region 441 455 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
low complexity region 569 587 N/A INTRINSIC
low complexity region 640 651 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
SPEC 779 880 1.06e-1 SMART
SPEC 959 1057 1.45e0 SMART
SPEC 1078 1185 2.56e-2 SMART
low complexity region 1316 1332 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1610 1622 N/A INTRINSIC
low complexity region 1683 1698 N/A INTRINSIC
low complexity region 1737 1781 N/A INTRINSIC
low complexity region 1899 1910 N/A INTRINSIC
low complexity region 2019 2031 N/A INTRINSIC
low complexity region 2104 2115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219786
AA Change: V45A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is highly expressed in various brain regions and cardiac and skeletal muscle. It is specifically localized to the sarcoplasmic reticulum and nuclear membrane, and is involved in anchoring PKA to the nuclear membrane or sarcoplasmic reticulum. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in partial embryonic lethality; surviving homozygotes display a decreased body weight, craniofacial defects and reduced viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik G T 8: 45,968,138 T116K probably damaging Het
Adgre1 A G 17: 57,410,947 I320V probably benign Het
Ankrd28 A T 14: 31,743,285 S312T probably damaging Het
Cenpn A G 8: 116,933,396 Y68C probably damaging Het
Cntn3 A T 6: 102,168,982 I966N probably benign Het
D630003M21Rik T C 2: 158,204,802 T752A probably benign Het
Dmxl2 A C 9: 54,419,884 S952R probably null Het
Dopey1 G A 9: 86,520,559 E1271K probably benign Het
Fgfr3 A G 5: 33,723,116 probably benign Het
Gm10110 A G 14: 89,897,715 noncoding transcript Het
Gm13089 T C 4: 143,698,148 M242V probably benign Het
Got1l1 C T 8: 27,198,485 M279I probably benign Het
Guf1 T C 5: 69,561,662 V230A probably benign Het
Hsd17b14 C T 7: 45,562,915 L124F probably benign Het
Id3 G T 4: 136,144,358 probably benign Het
Itga8 T C 2: 12,182,736 S711G probably benign Het
Lgr4 T C 2: 110,012,016 M782T possibly damaging Het
Lsm12 T C 11: 102,167,083 probably null Het
Map1b T A 13: 99,444,233 D117V probably damaging Het
Map3k11 A G 19: 5,702,210 T807A probably damaging Het
Mapk14 T C 17: 28,724,824 F129S probably damaging Het
Mapkbp1 T A 2: 120,023,693 I1257N possibly damaging Het
Mcm3 A G 1: 20,810,232 Y459H probably damaging Het
Mkln1 T C 6: 31,433,158 probably benign Het
Msh5 A T 17: 35,030,688 I627N possibly damaging Het
Nfkbiz T C 16: 55,816,841 H488R probably benign Het
Nrg1 G T 8: 32,477,077 probably benign Het
Olfr1477 A T 19: 13,502,622 Y93F probably benign Het
Olfr348 A G 2: 36,786,770 M82V probably benign Het
Olfr574 T C 7: 102,948,738 L81P probably damaging Het
Olfr635 T C 7: 103,979,441 V89A probably benign Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Plekhg4 T A 8: 105,380,402 C910S probably damaging Het
Ppp1r18 A G 17: 35,868,304 E357G probably damaging Het
Rbm11 T C 16: 75,596,587 F57S probably damaging Het
Sbp G A 17: 23,945,312 G183D probably benign Het
Skint5 A G 4: 113,742,185 V719A unknown Het
Slc16a7 T G 10: 125,233,439 probably null Het
Slc29a1 A C 17: 45,589,066 Y232* probably null Het
Slc7a8 C G 14: 54,735,790 G240A possibly damaging Het
Spanxn4 A T 12: 62,688,100 noncoding transcript Het
Spata31d1d T C 13: 59,728,554 Q389R probably benign Het
Srgap1 A G 10: 121,870,326 probably null Het
St6gal2 A T 17: 55,483,017 N351Y probably benign Het
Tle2 A G 10: 81,587,560 D491G probably damaging Het
Tmem33 T C 5: 67,286,125 V215A probably benign Het
Trav6-3 A G 14: 53,430,091 T7A probably benign Het
Ube2q2 C A 9: 55,149,800 P56T probably benign Het
Unc79 T C 12: 103,021,760 V208A probably damaging Het
Xkr7 T C 2: 153,054,633 I469T probably benign Het
Other mutations in Akap6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Akap6 APN 12 53140980 missense possibly damaging 0.79
IGL00505:Akap6 APN 12 52887102 missense possibly damaging 0.92
IGL01134:Akap6 APN 12 52937217 missense probably damaging 0.96
IGL01458:Akap6 APN 12 52886818 nonsense probably null
IGL01589:Akap6 APN 12 53139664 missense probably damaging 1.00
IGL01592:Akap6 APN 12 53142142 missense probably damaging 1.00
IGL01738:Akap6 APN 12 52886817 missense probably damaging 0.99
IGL01867:Akap6 APN 12 52888008 missense probably damaging 1.00
IGL02025:Akap6 APN 12 53140335 missense probably benign
IGL02041:Akap6 APN 12 53140653 missense probably damaging 1.00
IGL02058:Akap6 APN 12 53140555 missense probably damaging 1.00
IGL02194:Akap6 APN 12 52886823 missense probably benign 0.00
IGL02226:Akap6 APN 12 53010467 splice site probably benign
IGL02323:Akap6 APN 12 53140429 missense probably benign 0.00
IGL02449:Akap6 APN 12 53140188 missense probably damaging 1.00
IGL02475:Akap6 APN 12 53139494 missense probably benign 0.03
IGL02546:Akap6 APN 12 52880738 missense probably damaging 1.00
IGL02547:Akap6 APN 12 53140696 missense probably damaging 1.00
IGL02588:Akap6 APN 12 52886499 nonsense probably null
IGL02608:Akap6 APN 12 53010606 missense probably benign 0.39
IGL02884:Akap6 APN 12 52886622 missense probably benign 0.00
IGL02945:Akap6 APN 12 52880837 missense probably damaging 1.00
IGL03029:Akap6 APN 12 52886412 missense probably damaging 1.00
IGL03129:Akap6 APN 12 53140306 missense probably damaging 1.00
R0133:Akap6 UTSW 12 53139471 nonsense probably null
R0166:Akap6 UTSW 12 53140924 missense probably benign 0.04
R0189:Akap6 UTSW 12 53141254 missense probably benign 0.41
R0532:Akap6 UTSW 12 52887983 missense probably benign 0.00
R0632:Akap6 UTSW 12 52937148 missense probably damaging 1.00
R0666:Akap6 UTSW 12 52911808 missense probably damaging 1.00
R0723:Akap6 UTSW 12 53141902 missense probably damaging 1.00
R0763:Akap6 UTSW 12 53142214 missense possibly damaging 0.93
R0785:Akap6 UTSW 12 52886622 missense probably benign 0.00
R0879:Akap6 UTSW 12 52880799 missense probably damaging 1.00
R0880:Akap6 UTSW 12 53139508 missense possibly damaging 0.93
R1033:Akap6 UTSW 12 53069222 missense probably damaging 0.97
R1055:Akap6 UTSW 12 52880672 nonsense probably null
R1199:Akap6 UTSW 12 52796190 missense probably damaging 1.00
R1295:Akap6 UTSW 12 52887029 missense probably damaging 1.00
R1389:Akap6 UTSW 12 53139520 missense probably benign 0.15
R1471:Akap6 UTSW 12 53141496 missense probably benign 0.05
R1483:Akap6 UTSW 12 52796087 missense probably damaging 1.00
R1512:Akap6 UTSW 12 52937154 missense probably damaging 1.00
R1648:Akap6 UTSW 12 53142006 nonsense probably null
R1791:Akap6 UTSW 12 53069125 missense probably damaging 1.00
R1888:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1888:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1891:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1899:Akap6 UTSW 12 53141852 missense possibly damaging 0.95
R1917:Akap6 UTSW 12 53104612 missense probably benign 0.13
R1970:Akap6 UTSW 12 52938475 missense probably damaging 0.96
R1987:Akap6 UTSW 12 53140795 missense possibly damaging 0.78
R1988:Akap6 UTSW 12 53140795 missense possibly damaging 0.78
R2153:Akap6 UTSW 12 53141404 missense probably benign 0.03
R2567:Akap6 UTSW 12 52938373 missense probably damaging 1.00
R2568:Akap6 UTSW 12 52887278 missense possibly damaging 0.77
R3025:Akap6 UTSW 12 53140143 missense probably benign
R3051:Akap6 UTSW 12 52887033 missense probably damaging 1.00
R3195:Akap6 UTSW 12 53072457 nonsense probably null
R3196:Akap6 UTSW 12 53072457 nonsense probably null
R3426:Akap6 UTSW 12 52888034 missense probably damaging 1.00
R3783:Akap6 UTSW 12 52880769 missense probably damaging 1.00
R3934:Akap6 UTSW 12 53140444 missense possibly damaging 0.92
R3936:Akap6 UTSW 12 53140444 missense possibly damaging 0.92
R3967:Akap6 UTSW 12 53141453 missense probably damaging 1.00
R3970:Akap6 UTSW 12 53141453 missense probably damaging 1.00
R4042:Akap6 UTSW 12 53139379 critical splice acceptor site probably null
R4095:Akap6 UTSW 12 53139462 missense probably damaging 1.00
R4152:Akap6 UTSW 12 53140407 missense probably benign 0.45
R4231:Akap6 UTSW 12 53141038 missense probably damaging 1.00
R4232:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4233:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4234:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4235:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4236:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4475:Akap6 UTSW 12 53141643 missense probably benign 0.00
R4686:Akap6 UTSW 12 52887623 frame shift probably null
R4724:Akap6 UTSW 12 52795885 missense possibly damaging 0.80
R4782:Akap6 UTSW 12 52887623 frame shift probably null
R4852:Akap6 UTSW 12 53104675 missense probably damaging 1.00
R5024:Akap6 UTSW 12 53142562 missense probably benign 0.01
R5116:Akap6 UTSW 12 53141515 missense probably benign 0.01
R5164:Akap6 UTSW 12 53142466 missense probably benign
R5225:Akap6 UTSW 12 52886546 missense probably damaging 1.00
R5269:Akap6 UTSW 12 53139843 missense probably damaging 0.99
R5352:Akap6 UTSW 12 52796097 missense probably damaging 1.00
R5496:Akap6 UTSW 12 53140653 missense possibly damaging 0.87
R5551:Akap6 UTSW 12 52795964 missense probably damaging 1.00
R5997:Akap6 UTSW 12 52937233 critical splice donor site probably null
R6137:Akap6 UTSW 12 53140354 missense probably damaging 1.00
R6151:Akap6 UTSW 12 53025792 missense probably damaging 1.00
R6169:Akap6 UTSW 12 53142358 missense probably benign
R6307:Akap6 UTSW 12 53141568 missense possibly damaging 0.85
R6351:Akap6 UTSW 12 53142025 missense probably damaging 0.98
R6479:Akap6 UTSW 12 53141169 missense probably damaging 1.00
R6502:Akap6 UTSW 12 53140215 missense probably damaging 1.00
R6760:Akap6 UTSW 12 53139778 missense probably damaging 1.00
R6778:Akap6 UTSW 12 53025816 missense probably damaging 1.00
R6837:Akap6 UTSW 12 53141262 missense probably damaging 1.00
R6896:Akap6 UTSW 12 52887494 missense probably benign 0.06
R6917:Akap6 UTSW 12 53069168 missense probably null 0.97
R6983:Akap6 UTSW 12 52887653 missense probably damaging 1.00
R7142:Akap6 UTSW 12 52887364 missense probably benign 0.02
R7143:Akap6 UTSW 12 52887364 missense probably benign 0.02
R7216:Akap6 UTSW 12 53140457 missense probably benign 0.02
R7297:Akap6 UTSW 12 52887364 missense probably benign 0.02
R7356:Akap6 UTSW 12 52911864 missense probably damaging 1.00
R7378:Akap6 UTSW 12 53142574 missense probably benign 0.00
R7382:Akap6 UTSW 12 53142171 missense probably benign 0.00
R7498:Akap6 UTSW 12 53142705 nonsense probably null
R7542:Akap6 UTSW 12 53069234 missense probably damaging 1.00
R7589:Akap6 UTSW 12 53142063 nonsense probably null
R7676:Akap6 UTSW 12 52886850 missense possibly damaging 0.94
R7814:Akap6 UTSW 12 53140961 missense probably benign 0.28
R7971:Akap6 UTSW 12 53139795 missense probably damaging 1.00
R8039:Akap6 UTSW 12 53141676 missense probably benign 0.00
R8425:Akap6 UTSW 12 52886621 missense probably benign 0.00
R8747:Akap6 UTSW 12 53142216 missense probably benign 0.01
R8885:Akap6 UTSW 12 53141536 missense probably benign
R8956:Akap6 UTSW 12 53140344 missense probably benign 0.00
R8989:Akap6 UTSW 12 52880871 missense probably damaging 1.00
R9014:Akap6 UTSW 12 53139620 missense possibly damaging 0.60
R9031:Akap6 UTSW 12 53142048 missense probably benign 0.36
R9216:Akap6 UTSW 12 52880885 missense probably benign 0.05
R9220:Akap6 UTSW 12 53140449 missense possibly damaging 0.49
R9243:Akap6 UTSW 12 53141252 missense probably benign 0.08
R9286:Akap6 UTSW 12 53072471 missense possibly damaging 0.90
R9347:Akap6 UTSW 12 53069111 missense probably damaging 1.00
R9475:Akap6 UTSW 12 53010552 missense probably damaging 1.00
R9509:Akap6 UTSW 12 53142238 missense probably damaging 0.99
R9523:Akap6 UTSW 12 52795889 missense probably benign 0.02
R9600:Akap6 UTSW 12 52886558 missense probably benign 0.04
R9612:Akap6 UTSW 12 52911907 missense probably damaging 1.00
R9627:Akap6 UTSW 12 53104630 missense
R9666:Akap6 UTSW 12 53141535 missense probably benign
R9784:Akap6 UTSW 12 53141070 missense probably damaging 1.00
X0062:Akap6 UTSW 12 53142361 missense probably benign 0.43
Z1176:Akap6 UTSW 12 53140444 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TTGGCAAACTAGTCTGACTTTGC -3'
(R):5'- TGAACTAGATGCACATCCACATG -3'

Sequencing Primer
(F):5'- GGCAAACTAGTCTGACTTTGCTTTCC -3'
(R):5'- TAGATGCACATCCACATGCTTGC -3'
Posted On 2015-08-18