Mutagenetix > Incidental Mutations

Incidental Mutation 'R4513:Akap6'

334526

Institutional Source

Beutler Lab

Gene Symbol

Akap6

Ensembl Gene

ENSMUSG00000061603

Gene Name

A kinase (PRKA) anchor protein 6

Synonyms

MMRRC Submission

041759-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.698) question?

Stock #

R4513 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

52699383-53155599 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 52796004 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 45 (V45A)

Ref Sequence

ENSEMBL: ENSMUSP00000093406 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095737] [ENSMUST00000219786]

Predicted Effect

probably benign
Transcript: ENSMUST00000095737
AA Change: V45A

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000093406
Gene: ENSMUSG00000061603
AA Change: V45A

Domain	Start	End	E-Value	Type
low complexity region	34	51	N/A	INTRINSIC
Blast:SPEC	66	168	2e-50	BLAST
low complexity region	441	455	N/A	INTRINSIC
low complexity region	544	555	N/A	INTRINSIC
low complexity region	569	587	N/A	INTRINSIC
low complexity region	640	651	N/A	INTRINSIC
low complexity region	694	708	N/A	INTRINSIC
SPEC	779	880	1.06e-1	SMART
SPEC	959	1057	1.45e0	SMART
SPEC	1078	1185	2.56e-2	SMART
low complexity region	1316	1332	N/A	INTRINSIC
low complexity region	1555	1568	N/A	INTRINSIC
low complexity region	1610	1622	N/A	INTRINSIC
low complexity region	1683	1698	N/A	INTRINSIC
low complexity region	1737	1781	N/A	INTRINSIC
low complexity region	1899	1910	N/A	INTRINSIC
low complexity region	2019	2031	N/A	INTRINSIC
low complexity region	2104	2115	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000219786
AA Change: V45A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.6%
10x: 96.9%
20x: 94.0%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is highly expressed in various brain regions and cardiac and skeletal muscle. It is specifically localized to the sarcoplasmic reticulum and nuclear membrane, and is involved in anchoring PKA to the nuclear membrane or sarcoplasmic reticulum. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in partial embryonic lethality; surviving homozygotes display a decreased body weight, craniofacial defects and reduced viability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029J07Rik	G	T	8: 45,968,138	T116K	probably damaging	Het
Adgre1	A	G	17: 57,410,947	I320V	probably benign	Het
Ankrd28	A	T	14: 31,743,285	S312T	probably damaging	Het
Cenpn	A	G	8: 116,933,396	Y68C	probably damaging	Het
Cntn3	A	T	6: 102,168,982	I966N	probably benign	Het
D630003M21Rik	T	C	2: 158,204,802	T752A	probably benign	Het
Dmxl2	A	C	9: 54,419,884	S952R	probably null	Het
Dopey1	G	A	9: 86,520,559	E1271K	probably benign	Het
Fgfr3	A	G	5: 33,723,116		probably benign	Het
Gm10110	A	G	14: 89,897,715		noncoding transcript	Het
Gm13089	T	C	4: 143,698,148	M242V	probably benign	Het
Got1l1	C	T	8: 27,198,485	M279I	probably benign	Het
Guf1	T	C	5: 69,561,662	V230A	probably benign	Het
Hsd17b14	C	T	7: 45,562,915	L124F	probably benign	Het
Id3	G	T	4: 136,144,358		probably benign	Het
Itga8	T	C	2: 12,182,736	S711G	probably benign	Het
Lgr4	T	C	2: 110,012,016	M782T	possibly damaging	Het
Lsm12	T	C	11: 102,167,083		probably null	Het
Map1b	T	A	13: 99,444,233	D117V	probably damaging	Het
Map3k11	A	G	19: 5,702,210	T807A	probably damaging	Het
Mapk14	T	C	17: 28,724,824	F129S	probably damaging	Het
Mapkbp1	T	A	2: 120,023,693	I1257N	possibly damaging	Het
Mcm3	A	G	1: 20,810,232	Y459H	probably damaging	Het
Mkln1	T	C	6: 31,433,158		probably benign	Het
Msh5	A	T	17: 35,030,688	I627N	possibly damaging	Het
Nfkbiz	T	C	16: 55,816,841	H488R	probably benign	Het
Nrg1	G	T	8: 32,477,077		probably benign	Het
Olfr1477	A	T	19: 13,502,622	Y93F	probably benign	Het
Olfr348	A	G	2: 36,786,770	M82V	probably benign	Het
Olfr574	T	C	7: 102,948,738	L81P	probably damaging	Het
Olfr635	T	C	7: 103,979,441	V89A	probably benign	Het
Plec	C	T	15: 76,186,218	V931M	probably damaging	Het
Plekhg4	T	A	8: 105,380,402	C910S	probably damaging	Het
Ppp1r18	A	G	17: 35,868,304	E357G	probably damaging	Het
Rbm11	T	C	16: 75,596,587	F57S	probably damaging	Het
Sbp	G	A	17: 23,945,312	G183D	probably benign	Het
Skint5	A	G	4: 113,742,185	V719A	unknown	Het
Slc16a7	T	G	10: 125,233,439		probably null	Het
Slc29a1	A	C	17: 45,589,066	Y232*	probably null	Het
Slc7a8	C	G	14: 54,735,790	G240A	possibly damaging	Het
Spanxn4	A	T	12: 62,688,100		noncoding transcript	Het
Spata31d1d	T	C	13: 59,728,554	Q389R	probably benign	Het
Srgap1	A	G	10: 121,870,326		probably null	Het
St6gal2	A	T	17: 55,483,017	N351Y	probably benign	Het
Tle2	A	G	10: 81,587,560	D491G	probably damaging	Het
Tmem33	T	C	5: 67,286,125	V215A	probably benign	Het
Trav6-3	A	G	14: 53,430,091	T7A	probably benign	Het
Ube2q2	C	A	9: 55,149,800	P56T	probably benign	Het
Unc79	T	C	12: 103,021,760	V208A	probably damaging	Het
Xkr7	T	C	2: 153,054,633	I469T	probably benign	Het

Other mutations in Akap6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Akap6	APN	12	53140980	missense	possibly damaging	0.79
IGL00505:Akap6	APN	12	52887102	missense	possibly damaging	0.92
IGL01134:Akap6	APN	12	52937217	missense	probably damaging	0.96
IGL01458:Akap6	APN	12	52886818	nonsense	probably null
IGL01589:Akap6	APN	12	53139664	missense	probably damaging	1.00
IGL01592:Akap6	APN	12	53142142	missense	probably damaging	1.00
IGL01738:Akap6	APN	12	52886817	missense	probably damaging	0.99
IGL01867:Akap6	APN	12	52888008	missense	probably damaging	1.00
IGL02025:Akap6	APN	12	53140335	missense	probably benign
IGL02041:Akap6	APN	12	53140653	missense	probably damaging	1.00
IGL02058:Akap6	APN	12	53140555	missense	probably damaging	1.00
IGL02194:Akap6	APN	12	52886823	missense	probably benign	0.00
IGL02226:Akap6	APN	12	53010467	splice site	probably benign
IGL02323:Akap6	APN	12	53140429	missense	probably benign	0.00
IGL02449:Akap6	APN	12	53140188	missense	probably damaging	1.00
IGL02475:Akap6	APN	12	53139494	missense	probably benign	0.03
IGL02546:Akap6	APN	12	52880738	missense	probably damaging	1.00
IGL02547:Akap6	APN	12	53140696	missense	probably damaging	1.00
IGL02588:Akap6	APN	12	52886499	nonsense	probably null
IGL02608:Akap6	APN	12	53010606	missense	probably benign	0.39
IGL02884:Akap6	APN	12	52886622	missense	probably benign	0.00
IGL02945:Akap6	APN	12	52880837	missense	probably damaging	1.00
IGL03029:Akap6	APN	12	52886412	missense	probably damaging	1.00
IGL03129:Akap6	APN	12	53140306	missense	probably damaging	1.00
R0133:Akap6	UTSW	12	53139471	nonsense	probably null
R0166:Akap6	UTSW	12	53140924	missense	probably benign	0.04
R0189:Akap6	UTSW	12	53141254	missense	probably benign	0.41
R0532:Akap6	UTSW	12	52887983	missense	probably benign	0.00
R0632:Akap6	UTSW	12	52937148	missense	probably damaging	1.00
R0666:Akap6	UTSW	12	52911808	missense	probably damaging	1.00
R0723:Akap6	UTSW	12	53141902	missense	probably damaging	1.00
R0763:Akap6	UTSW	12	53142214	missense	possibly damaging	0.93
R0785:Akap6	UTSW	12	52886622	missense	probably benign	0.00
R0879:Akap6	UTSW	12	52880799	missense	probably damaging	1.00
R0880:Akap6	UTSW	12	53139508	missense	possibly damaging	0.93
R1033:Akap6	UTSW	12	53069222	missense	probably damaging	0.97
R1055:Akap6	UTSW	12	52880672	nonsense	probably null
R1199:Akap6	UTSW	12	52796190	missense	probably damaging	1.00
R1295:Akap6	UTSW	12	52887029	missense	probably damaging	1.00
R1389:Akap6	UTSW	12	53139520	missense	probably benign	0.15
R1471:Akap6	UTSW	12	53141496	missense	probably benign	0.05
R1483:Akap6	UTSW	12	52796087	missense	probably damaging	1.00
R1512:Akap6	UTSW	12	52937154	missense	probably damaging	1.00
R1648:Akap6	UTSW	12	53142006	nonsense	probably null
R1791:Akap6	UTSW	12	53069125	missense	probably damaging	1.00
R1888:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1888:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1891:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1899:Akap6	UTSW	12	53141852	missense	possibly damaging	0.95
R1917:Akap6	UTSW	12	53104612	missense	probably benign	0.13
R1970:Akap6	UTSW	12	52938475	missense	probably damaging	0.96
R1987:Akap6	UTSW	12	53140795	missense	possibly damaging	0.78
R1988:Akap6	UTSW	12	53140795	missense	possibly damaging	0.78
R2153:Akap6	UTSW	12	53141404	missense	probably benign	0.03
R2567:Akap6	UTSW	12	52938373	missense	probably damaging	1.00
R2568:Akap6	UTSW	12	52887278	missense	possibly damaging	0.77
R3025:Akap6	UTSW	12	53140143	missense	probably benign
R3051:Akap6	UTSW	12	52887033	missense	probably damaging	1.00
R3195:Akap6	UTSW	12	53072457	nonsense	probably null
R3196:Akap6	UTSW	12	53072457	nonsense	probably null
R3426:Akap6	UTSW	12	52888034	missense	probably damaging	1.00
R3783:Akap6	UTSW	12	52880769	missense	probably damaging	1.00
R3934:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92
R3936:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92
R3967:Akap6	UTSW	12	53141453	missense	probably damaging	1.00
R3970:Akap6	UTSW	12	53141453	missense	probably damaging	1.00
R4042:Akap6	UTSW	12	53139379	critical splice acceptor site	probably null
R4095:Akap6	UTSW	12	53139462	missense	probably damaging	1.00
R4152:Akap6	UTSW	12	53140407	missense	probably benign	0.45
R4231:Akap6	UTSW	12	53141038	missense	probably damaging	1.00
R4232:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4233:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4234:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4235:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4236:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4475:Akap6	UTSW	12	53141643	missense	probably benign	0.00
R4686:Akap6	UTSW	12	52887623	frame shift	probably null
R4724:Akap6	UTSW	12	52795885	missense	possibly damaging	0.80
R4782:Akap6	UTSW	12	52887623	frame shift	probably null
R4852:Akap6	UTSW	12	53104675	missense	probably damaging	1.00
R5024:Akap6	UTSW	12	53142562	missense	probably benign	0.01
R5116:Akap6	UTSW	12	53141515	missense	probably benign	0.01
R5164:Akap6	UTSW	12	53142466	missense	probably benign
R5225:Akap6	UTSW	12	52886546	missense	probably damaging	1.00
R5269:Akap6	UTSW	12	53139843	missense	probably damaging	0.99
R5352:Akap6	UTSW	12	52796097	missense	probably damaging	1.00
R5496:Akap6	UTSW	12	53140653	missense	possibly damaging	0.87
R5551:Akap6	UTSW	12	52795964	missense	probably damaging	1.00
R5997:Akap6	UTSW	12	52937233	critical splice donor site	probably null
R6137:Akap6	UTSW	12	53140354	missense	probably damaging	1.00
R6151:Akap6	UTSW	12	53025792	missense	probably damaging	1.00
R6169:Akap6	UTSW	12	53142358	missense	probably benign
R6307:Akap6	UTSW	12	53141568	missense	possibly damaging	0.85
R6351:Akap6	UTSW	12	53142025	missense	probably damaging	0.98
R6479:Akap6	UTSW	12	53141169	missense	probably damaging	1.00
R6502:Akap6	UTSW	12	53140215	missense	probably damaging	1.00
R6760:Akap6	UTSW	12	53139778	missense	probably damaging	1.00
R6778:Akap6	UTSW	12	53025816	missense	probably damaging	1.00
R6837:Akap6	UTSW	12	53141262	missense	probably damaging	1.00
R6896:Akap6	UTSW	12	52887494	missense	probably benign	0.06
R6917:Akap6	UTSW	12	53069168	missense	probably null	0.97
R6983:Akap6	UTSW	12	52887653	missense	probably damaging	1.00
R7142:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7143:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7216:Akap6	UTSW	12	53140457	missense	probably benign	0.02
R7297:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7356:Akap6	UTSW	12	52911864	missense	probably damaging	1.00
R7378:Akap6	UTSW	12	53142574	missense	probably benign	0.00
R7382:Akap6	UTSW	12	53142171	missense	probably benign	0.00
R7498:Akap6	UTSW	12	53142705	nonsense	probably null
R7542:Akap6	UTSW	12	53069234	missense	probably damaging	1.00
R7589:Akap6	UTSW	12	53142063	nonsense	probably null
R7676:Akap6	UTSW	12	52886850	missense	possibly damaging	0.94
R7814:Akap6	UTSW	12	53140961	missense	probably benign	0.28
R8039:Akap6	UTSW	12	53141676	missense	probably benign	0.00
X0062:Akap6	UTSW	12	53142361	missense	probably benign	0.43
Z1176:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- TTGGCAAACTAGTCTGACTTTGC -3'
(R):5'- TGAACTAGATGCACATCCACATG -3'

Sequencing Primer
(F):5'- GGCAAACTAGTCTGACTTTGCTTTCC -3'
(R):5'- TAGATGCACATCCACATGCTTGC -3'

Posted On

2015-08-18