Mutagenetix > Incidental Mutation

Incidental Mutation 'R4513:Map1b'

334530

Institutional Source

Beutler Lab

Gene Symbol

Map1b

Ensembl Gene

ENSMUSG00000052727

Gene Name

microtubule-associated protein 1B

Synonyms

Mtap1b, MAP5, Mtap-5, Mtap5, LC1

MMRRC Submission

041759-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4513 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99421446-99516540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 99444233 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 117 (D117V)

Ref Sequence

ENSEMBL: ENSMUSP00000068374 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064762] [ENSMUST00000223725]

AlphaFold

P14873

Predicted Effect

probably damaging
Transcript: ENSMUST00000064762
AA Change: D117V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: D117V

Domain	Start	End	E-Value	Type
low complexity region	41	50	N/A	INTRINSIC
Blast:Lactamase_B	270	514	1e-56	BLAST
low complexity region	578	595	N/A	INTRINSIC
low complexity region	597	617	N/A	INTRINSIC
SCOP:d1gkub2	633	735	8e-4	SMART
low complexity region	771	813	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	889	913	N/A	INTRINSIC
low complexity region	935	956	N/A	INTRINSIC
low complexity region	1006	1030	N/A	INTRINSIC
low complexity region	1247	1261	N/A	INTRINSIC
low complexity region	1390	1404	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
low complexity region	1724	1735	N/A	INTRINSIC
Pfam:MAP1B_neuraxin	1891	1907	1.9e-10	PFAM
Pfam:MAP1B_neuraxin	1908	1924	8.3e-11	PFAM
Pfam:MAP1B_neuraxin	1942	1958	3.1e-9	PFAM
Pfam:MAP1B_neuraxin	1959	1975	6.2e-9	PFAM
Pfam:MAP1B_neuraxin	2027	2043	2.9e-10	PFAM
Pfam:MAP1B_neuraxin	2044	2060	3.9e-9	PFAM
low complexity region	2227	2257	N/A	INTRINSIC
low complexity region	2286	2307	N/A	INTRINSIC
low complexity region	2316	2343	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223693

Predicted Effect

probably benign
Transcript: ENSMUST00000223725

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224605

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224702

Meta Mutation Damage Score

0.1863

Coding Region Coverage

1x: 99.4%
3x: 98.6%
10x: 96.9%
20x: 94.0%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029J07Rik	G	T	8: 45,968,138	T116K	probably damaging	Het
Adgre1	A	G	17: 57,410,947	I320V	probably benign	Het
Akap6	T	C	12: 52,796,004	V45A	probably benign	Het
Ankrd28	A	T	14: 31,743,285	S312T	probably damaging	Het
Cenpn	A	G	8: 116,933,396	Y68C	probably damaging	Het
Cntn3	A	T	6: 102,168,982	I966N	probably benign	Het
D630003M21Rik	T	C	2: 158,204,802	T752A	probably benign	Het
Dmxl2	A	C	9: 54,419,884	S952R	probably null	Het
Dopey1	G	A	9: 86,520,559	E1271K	probably benign	Het
Fgfr3	A	G	5: 33,723,116		probably benign	Het
Gm10110	A	G	14: 89,897,715		noncoding transcript	Het
Gm13089	T	C	4: 143,698,148	M242V	probably benign	Het
Got1l1	C	T	8: 27,198,485	M279I	probably benign	Het
Guf1	T	C	5: 69,561,662	V230A	probably benign	Het
Hsd17b14	C	T	7: 45,562,915	L124F	probably benign	Het
Id3	G	T	4: 136,144,358		probably benign	Het
Itga8	T	C	2: 12,182,736	S711G	probably benign	Het
Lgr4	T	C	2: 110,012,016	M782T	possibly damaging	Het
Lsm12	T	C	11: 102,167,083		probably null	Het
Map3k11	A	G	19: 5,702,210	T807A	probably damaging	Het
Mapk14	T	C	17: 28,724,824	F129S	probably damaging	Het
Mapkbp1	T	A	2: 120,023,693	I1257N	possibly damaging	Het
Mcm3	A	G	1: 20,810,232	Y459H	probably damaging	Het
Mkln1	T	C	6: 31,433,158		probably benign	Het
Msh5	A	T	17: 35,030,688	I627N	possibly damaging	Het
Nfkbiz	T	C	16: 55,816,841	H488R	probably benign	Het
Nrg1	G	T	8: 32,477,077		probably benign	Het
Olfr1477	A	T	19: 13,502,622	Y93F	probably benign	Het
Olfr348	A	G	2: 36,786,770	M82V	probably benign	Het
Olfr574	T	C	7: 102,948,738	L81P	probably damaging	Het
Olfr635	T	C	7: 103,979,441	V89A	probably benign	Het
Plec	C	T	15: 76,186,218	V931M	probably damaging	Het
Plekhg4	T	A	8: 105,380,402	C910S	probably damaging	Het
Ppp1r18	A	G	17: 35,868,304	E357G	probably damaging	Het
Rbm11	T	C	16: 75,596,587	F57S	probably damaging	Het
Sbp	G	A	17: 23,945,312	G183D	probably benign	Het
Skint5	A	G	4: 113,742,185	V719A	unknown	Het
Slc16a7	T	G	10: 125,233,439		probably null	Het
Slc29a1	A	C	17: 45,589,066	Y232*	probably null	Het
Slc7a8	C	G	14: 54,735,790	G240A	possibly damaging	Het
Spanxn4	A	T	12: 62,688,100		noncoding transcript	Het
Spata31d1d	T	C	13: 59,728,554	Q389R	probably benign	Het
Srgap1	A	G	10: 121,870,326		probably null	Het
St6gal2	A	T	17: 55,483,017	N351Y	probably benign	Het
Tle2	A	G	10: 81,587,560	D491G	probably damaging	Het
Tmem33	T	C	5: 67,286,125	V215A	probably benign	Het
Trav6-3	A	G	14: 53,430,091	T7A	probably benign	Het
Ube2q2	C	A	9: 55,149,800	P56T	probably benign	Het
Unc79	T	C	12: 103,021,760	V208A	probably damaging	Het
Xkr7	T	C	2: 153,054,633	I469T	probably benign	Het

Other mutations in Map1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Map1b	APN	13	99429233	missense	unknown
IGL00533:Map1b	APN	13	99432604	missense	unknown
IGL00801:Map1b	APN	13	99430097	missense	unknown
IGL01141:Map1b	APN	13	99434761	missense	probably damaging	1.00
IGL01418:Map1b	APN	13	99431830	missense	unknown
IGL01464:Map1b	APN	13	99432743	missense	unknown
IGL01690:Map1b	APN	13	99435004	missense	probably damaging	1.00
IGL01991:Map1b	APN	13	99429569	missense	unknown
IGL02245:Map1b	APN	13	99431528	missense	unknown
IGL02376:Map1b	APN	13	99435595	missense	probably damaging	1.00
IGL02380:Map1b	APN	13	99431143	missense	unknown
IGL02442:Map1b	APN	13	99508198	missense	probably damaging	1.00
IGL02465:Map1b	APN	13	99433406	missense	unknown
IGL02816:Map1b	APN	13	99441755	missense	probably damaging	1.00
IGL02859:Map1b	APN	13	99433036	missense	unknown
IGL02934:Map1b	APN	13	99435131	missense	probably benign	0.09
IGL02970:Map1b	APN	13	99430734	nonsense	probably null
IGL03148:Map1b	APN	13	99441695	missense	probably damaging	1.00
IGL03401:Map1b	APN	13	99427268	missense	unknown
IGL03138:Map1b	UTSW	13	99425826	missense	unknown
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0035:Map1b	UTSW	13	99435338	missense	probably damaging	1.00
R0069:Map1b	UTSW	13	99429848	missense	unknown
R0315:Map1b	UTSW	13	99431116	missense	unknown
R0539:Map1b	UTSW	13	99434018	missense	unknown
R0548:Map1b	UTSW	13	99431683	missense	unknown
R0613:Map1b	UTSW	13	99441641	missense	probably damaging	1.00
R0730:Map1b	UTSW	13	99429766	nonsense	probably null
R1103:Map1b	UTSW	13	99427466	splice site	probably benign
R1300:Map1b	UTSW	13	99432521	missense	unknown
R1353:Map1b	UTSW	13	99427326	missense	unknown
R1387:Map1b	UTSW	13	99432650	missense	unknown
R1481:Map1b	UTSW	13	99431171	missense	unknown
R1509:Map1b	UTSW	13	99431528	missense	unknown
R1521:Map1b	UTSW	13	99432739	missense	unknown
R1604:Map1b	UTSW	13	99429572	missense	unknown
R1649:Map1b	UTSW	13	99516478	missense	probably benign	0.03
R1651:Map1b	UTSW	13	99432583	missense	unknown
R1661:Map1b	UTSW	13	99431929	missense	unknown
R1665:Map1b	UTSW	13	99431929	missense	unknown
R1770:Map1b	UTSW	13	99430493	missense	unknown
R1926:Map1b	UTSW	13	99430692	missense	unknown
R1928:Map1b	UTSW	13	99430946	missense	unknown
R2093:Map1b	UTSW	13	99429670	missense	unknown
R2110:Map1b	UTSW	13	99431121	missense	unknown
R2116:Map1b	UTSW	13	99430644	missense	unknown
R2164:Map1b	UTSW	13	99429338	missense	unknown
R2207:Map1b	UTSW	13	99431083	missense	unknown
R2273:Map1b	UTSW	13	99432084	missense	unknown
R2443:Map1b	UTSW	13	99430411	missense	unknown
R3054:Map1b	UTSW	13	99432742	missense	unknown
R3766:Map1b	UTSW	13	99434087	missense	unknown
R3911:Map1b	UTSW	13	99431072	missense	unknown
R4005:Map1b	UTSW	13	99429907	missense	unknown
R4130:Map1b	UTSW	13	99431680	missense	unknown
R4613:Map1b	UTSW	13	99430302	nonsense	probably null
R4633:Map1b	UTSW	13	99434942	missense	probably damaging	1.00
R4646:Map1b	UTSW	13	99432469	missense	unknown
R4690:Map1b	UTSW	13	99431068	missense	unknown
R4704:Map1b	UTSW	13	99430475	missense	unknown
R4836:Map1b	UTSW	13	99431054	missense	unknown
R4916:Map1b	UTSW	13	99433300	missense	unknown
R4951:Map1b	UTSW	13	99432427	missense	unknown
R4960:Map1b	UTSW	13	99432212	missense	probably benign	0.23
R4961:Map1b	UTSW	13	99435653	missense	probably damaging	1.00
R5030:Map1b	UTSW	13	99434174	missense	unknown
R5090:Map1b	UTSW	13	99430026	nonsense	probably null
R5469:Map1b	UTSW	13	99429338	missense	unknown
R5820:Map1b	UTSW	13	99432824	missense	unknown
R5885:Map1b	UTSW	13	99430081	missense	unknown
R5915:Map1b	UTSW	13	99430331	missense	unknown
R5923:Map1b	UTSW	13	99433153	missense	unknown
R6063:Map1b	UTSW	13	99431137	missense	unknown
R6102:Map1b	UTSW	13	99425873	missense	unknown
R6218:Map1b	UTSW	13	99433206	missense	unknown
R6435:Map1b	UTSW	13	99516363	missense	probably damaging	0.99
R6663:Map1b	UTSW	13	99430022	missense	unknown
R6765:Map1b	UTSW	13	99425941	missense	unknown
R6860:Map1b	UTSW	13	99434767	missense	probably damaging	1.00
R6997:Map1b	UTSW	13	99430634	missense	unknown
R7001:Map1b	UTSW	13	99430593	missense	unknown
R7310:Map1b	UTSW	13	99433655	missense	unknown
R7349:Map1b	UTSW	13	99433640	missense	unknown
R7448:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7449:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7452:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7810:Map1b	UTSW	13	99431882	missense	unknown
R7820:Map1b	UTSW	13	99431177	missense	unknown
R8396:Map1b	UTSW	13	99434113	missense	unknown
R8470:Map1b	UTSW	13	99516442	missense	probably damaging	0.98
R8535:Map1b	UTSW	13	99435154	missense	probably damaging	1.00
R8777:Map1b	UTSW	13	99430796	missense	unknown
R8777-TAIL:Map1b	UTSW	13	99430796	missense	unknown
R8812:Map1b	UTSW	13	99432815	missense	unknown
R8903:Map1b	UTSW	13	99432509	nonsense	probably null
R8928:Map1b	UTSW	13	99432116	missense	unknown
R8954:Map1b	UTSW	13	99434227	missense	unknown
R9164:Map1b	UTSW	13	99425843	missense	unknown
R9164:Map1b	UTSW	13	99432308	nonsense	probably null
R9190:Map1b	UTSW	13	99435406	missense	probably damaging	0.99
R9334:Map1b	UTSW	13	99431640	missense	unknown
R9339:Map1b	UTSW	13	99431062	missense	unknown
R9357:Map1b	UTSW	13	99430200	nonsense	probably null
R9430:Map1b	UTSW	13	99434108	missense	unknown
RF003:Map1b	UTSW	13	99430750	missense	unknown
X0019:Map1b	UTSW	13	99429968	missense	unknown
X0019:Map1b	UTSW	13	99432412	missense	unknown
Z1088:Map1b	UTSW	13	99508115	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- AAAGAGGCTTCTGGTGAGC -3'
(R):5'- TGTGTTTCCCAGCTTCCAGG -3'

Sequencing Primer
(F):5'- CTGGTGCTATGATACTAGATGCAGAG -3'
(R):5'- GGCCACATCTGAGTTGGAAATTTCTC -3'

Posted On

2015-08-18