Incidental Mutation 'R4513:Map3k11'
ID334544
Institutional Source Beutler Lab
Gene Symbol Map3k11
Ensembl Gene ENSMUSG00000004054
Gene Namemitogen-activated protein kinase kinase kinase 11
SynonymsMlk3, 2610017K16Rik
MMRRC Submission 041759-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.402) question?
Stock #R4513 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location5689131-5702862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5702210 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 807 (T807A)
Ref Sequence ENSEMBL: ENSMUSP00000004156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004156] [ENSMUST00000052448]
Predicted Effect probably damaging
Transcript: ENSMUST00000004156
AA Change: T807A

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000004156
Gene: ENSMUSG00000004054
AA Change: T807A

DomainStartEndE-ValueType
low complexity region 11 36 N/A INTRINSIC
SH3 45 105 6.79e-19 SMART
TyrKc 118 377 6.83e-81 SMART
coiled coil region 398 444 N/A INTRINSIC
low complexity region 467 476 N/A INTRINSIC
low complexity region 593 610 N/A INTRINSIC
low complexity region 614 632 N/A INTRINSIC
low complexity region 676 697 N/A INTRINSIC
low complexity region 759 778 N/A INTRINSIC
low complexity region 786 805 N/A INTRINSIC
low complexity region 809 820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052448
SMART Domains Protein: ENSMUSP00000051278
Gene: ENSMUSG00000024936

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Ion_trans_2 67 145 3.2e-14 PFAM
Pfam:Ion_trans_2 175 261 8.8e-12 PFAM
Meta Mutation Damage Score 0.0592 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine kinase family. This kinase contains a SH3 domain and a leucine zipper-basic motif. This kinase preferentially activates MAPK8/JNK kinase, and functions as a positive regulator of JNK signaling pathway. This kinase can directly phosphorylate, and activates IkappaB kinase alpha and beta, and is found to be involved in the transcription activity of NF-kappaB mediated by Rho family GTPases and CDC42. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted or spontaneous mutation display a pattern of dark red stripes of thin dorsal epithelium during pre-wean development, and necrotic dental pulp has been reported for the spontaneous mutant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik G T 8: 45,968,138 T116K probably damaging Het
Adgre1 A G 17: 57,410,947 I320V probably benign Het
Akap6 T C 12: 52,796,004 V45A probably benign Het
Ankrd28 A T 14: 31,743,285 S312T probably damaging Het
Cenpn A G 8: 116,933,396 Y68C probably damaging Het
Cntn3 A T 6: 102,168,982 I966N probably benign Het
D630003M21Rik T C 2: 158,204,802 T752A probably benign Het
Dmxl2 A C 9: 54,419,884 S952R probably null Het
Dopey1 G A 9: 86,520,559 E1271K probably benign Het
Fgfr3 A G 5: 33,723,116 probably benign Het
Gm10110 A G 14: 89,897,715 noncoding transcript Het
Gm13089 T C 4: 143,698,148 M242V probably benign Het
Got1l1 C T 8: 27,198,485 M279I probably benign Het
Guf1 T C 5: 69,561,662 V230A probably benign Het
Hsd17b14 C T 7: 45,562,915 L124F probably benign Het
Id3 G T 4: 136,144,358 probably benign Het
Itga8 T C 2: 12,182,736 S711G probably benign Het
Lgr4 T C 2: 110,012,016 M782T possibly damaging Het
Lsm12 T C 11: 102,167,083 probably null Het
Map1b T A 13: 99,444,233 D117V probably damaging Het
Mapk14 T C 17: 28,724,824 F129S probably damaging Het
Mapkbp1 T A 2: 120,023,693 I1257N possibly damaging Het
Mcm3 A G 1: 20,810,232 Y459H probably damaging Het
Mkln1 T C 6: 31,433,158 probably benign Het
Msh5 A T 17: 35,030,688 I627N possibly damaging Het
Nfkbiz T C 16: 55,816,841 H488R probably benign Het
Nrg1 G T 8: 32,477,077 probably benign Het
Olfr1477 A T 19: 13,502,622 Y93F probably benign Het
Olfr348 A G 2: 36,786,770 M82V probably benign Het
Olfr574 T C 7: 102,948,738 L81P probably damaging Het
Olfr635 T C 7: 103,979,441 V89A probably benign Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Plekhg4 T A 8: 105,380,402 C910S probably damaging Het
Ppp1r18 A G 17: 35,868,304 E357G probably damaging Het
Rbm11 T C 16: 75,596,587 F57S probably damaging Het
Sbp G A 17: 23,945,312 G183D probably benign Het
Skint5 A G 4: 113,742,185 V719A unknown Het
Slc16a7 T G 10: 125,233,439 probably null Het
Slc29a1 A C 17: 45,589,066 Y232* probably null Het
Slc7a8 C G 14: 54,735,790 G240A possibly damaging Het
Spanxn4 A T 12: 62,688,100 noncoding transcript Het
Spata31d1d T C 13: 59,728,554 Q389R probably benign Het
Srgap1 A G 10: 121,870,326 probably null Het
St6gal2 A T 17: 55,483,017 N351Y probably benign Het
Tle2 A G 10: 81,587,560 D491G probably damaging Het
Tmem33 T C 5: 67,286,125 V215A probably benign Het
Trav6-3 A G 14: 53,430,091 T7A probably benign Het
Ube2q2 C A 9: 55,149,800 P56T probably benign Het
Unc79 T C 12: 103,021,760 V208A probably damaging Het
Xkr7 T C 2: 153,054,633 I469T probably benign Het
Other mutations in Map3k11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02017:Map3k11 APN 19 5697623 missense possibly damaging 0.91
IGL02581:Map3k11 APN 19 5700806 missense probably benign
R0130:Map3k11 UTSW 19 5690815 missense probably damaging 1.00
R0193:Map3k11 UTSW 19 5695846 missense probably damaging 0.99
R1621:Map3k11 UTSW 19 5690806 missense probably damaging 1.00
R1736:Map3k11 UTSW 19 5697401 missense probably benign 0.34
R1791:Map3k11 UTSW 19 5695572 nonsense probably null
R3500:Map3k11 UTSW 19 5690247 start codon destroyed probably benign 0.08
R3836:Map3k11 UTSW 19 5690803 missense possibly damaging 0.71
R3892:Map3k11 UTSW 19 5702283 missense probably benign 0.13
R4303:Map3k11 UTSW 19 5690824 missense probably damaging 1.00
R4613:Map3k11 UTSW 19 5697470 missense probably benign 0.18
R4613:Map3k11 UTSW 19 5697471 missense probably damaging 0.98
R4631:Map3k11 UTSW 19 5690913 missense probably benign 0.30
R4780:Map3k11 UTSW 19 5690938 missense probably damaging 0.99
R5213:Map3k11 UTSW 19 5690641 missense probably damaging 0.99
R5266:Map3k11 UTSW 19 5700594 missense probably benign 0.03
R5372:Map3k11 UTSW 19 5690962 missense probably damaging 1.00
R5736:Map3k11 UTSW 19 5696711 missense probably damaging 1.00
R5899:Map3k11 UTSW 19 5695909 critical splice donor site probably null
R6052:Map3k11 UTSW 19 5697402 missense probably benign 0.01
R6388:Map3k11 UTSW 19 5690251 missense probably damaging 0.96
R6623:Map3k11 UTSW 19 5695603 missense probably damaging 0.97
R6975:Map3k11 UTSW 19 5690727 missense possibly damaging 0.91
R7309:Map3k11 UTSW 19 5690458 missense probably damaging 0.99
R7771:Map3k11 UTSW 19 5690608 missense probably damaging 0.99
R7815:Map3k11 UTSW 19 5695639 missense possibly damaging 0.89
X0025:Map3k11 UTSW 19 5696195 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCCTAACCATGTACCCGTAC -3'
(R):5'- GTATGCTATGCCTCCTCGAAGG -3'

Sequencing Primer
(F):5'- AGGAATATCACGCTCTGCTC -3'
(R):5'- TCCTCGAAGGCAGCCGAAG -3'
Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation.
 

PCR Primers

R45130056_PCR_F: 5’- GCCTAACCATGTACCCGTAC-3’

R45130056_PCR_R: 5’- GTATGCTATGCCTCCTCGAAGG-3’

 

Sequencing Primers

R45130056_SEQ_F: 5’- AGGAATATCACGCTCTGCTC-3’
 

R45130056_SEQ_R: 5’- TCCTCGAAGGCAGCCGAAG-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 427 nucleotides is amplified (NCBI RefSeq: NC_000085, chromosome 19:5701971-5702397):

  

gcctaaccat gtacccgtac ttttataccc ccatagggag aaccgtctca cccccaccag        

gaatatcacg ctctgctcct ggcacacctg gaacccctcg ctcaccaccg ttgggcctaa      

tcagccgacc tcggccctca ccactccgta gccgtattga cccatggagc ttcgtgtcag      

ctgggccacg gccttcaccc ctgccctctc cacagcctgc accccgacgg gcaccgtgga      

ccttattccc agactcagat cccttctggg actccccacc tgccaacccc ttccggggag      

gctcccagga ctgcaggacg cagaccaaag acatgggtgc ccaggcccca tgggcaccag      

aagcagggcc ctgagtgggc cagaccacac cccacgcttc ggctgccttc gaggaggcat      

agcatac

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text.

Posted On2015-08-18