Incidental Mutation 'R3123:Cyp2j8'
ID334551
Institutional Source Beutler Lab
Gene Symbol Cyp2j8
Ensembl Gene ENSMUSG00000082932
Gene Namecytochrome P450, family 2, subfamily j, polypeptide 8
SynonymsCyp2j8-ps, OTTMUSG00000007938
MMRRC Submission 040596-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R3123 (G1)
Quality Score21
Status Validated
Chromosome4
Chromosomal Location96444596-96507386 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 96501213 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124729]
Predicted Effect probably benign
Transcript: ENSMUST00000124729
SMART Domains Protein: ENSMUSP00000134591
Gene: ENSMUSG00000082932

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 44 500 1.2e-134 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak9 A G 10: 41,358,580 I646V possibly damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Caskin2 T C 11: 115,804,797 D246G probably damaging Het
Csn1s2b T C 5: 87,819,058 probably benign Het
Ctsa T A 2: 164,835,232 probably null Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Dhx9 T C 1: 153,465,706 K599E possibly damaging Het
Duox2 A G 2: 122,281,073 probably benign Het
F2rl3 T C 8: 72,763,212 S356P probably damaging Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Glra3 A G 8: 56,125,209 R434G possibly damaging Het
Gpr75 T A 11: 30,891,709 S205T possibly damaging Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Htt T C 5: 34,804,531 S287P probably benign Het
Ifi27l2b T C 12: 103,451,335 T198A unknown Het
Kdm5d T C Y: 900,558 V201A possibly damaging Het
Khdrbs2 C A 1: 32,519,777 R408L probably damaging Het
Lonp1 A G 17: 56,626,488 I129T possibly damaging Het
Macc1 T C 12: 119,447,633 F712S probably damaging Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Nop2 G A 6: 125,132,201 probably benign Het
Olfr1115 A T 2: 87,252,791 T285S possibly damaging Het
Olfr131 G A 17: 38,082,012 probably null Het
Olfr166 A G 16: 19,487,015 Y59C probably damaging Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Pkd1l1 T A 11: 8,973,021 D82V unknown Het
Polr2a A T 11: 69,735,710 S1566T possibly damaging Het
Ppwd1 C T 13: 104,213,690 E396K possibly damaging Het
Prr30 A G 14: 101,198,989 S46P probably benign Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Ptpn4 A G 1: 119,765,423 probably null Het
Rad18 A T 6: 112,681,346 D199E probably benign Het
Ralgps1 T C 2: 33,158,956 T314A possibly damaging Het
Rbm27 A G 18: 42,327,165 E764G probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Taf15 G A 11: 83,504,328 probably null Het
Tas2r140 T A 6: 133,055,241 I185L probably benign Het
Tgfbr2 G A 9: 116,110,069 T230M possibly damaging Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Upf1 A G 8: 70,337,483 probably benign Het
Vmn2r109 C T 17: 20,540,986 C703Y probably damaging Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Zfp777 A G 6: 48,029,116 probably benign Het
Other mutations in Cyp2j8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Cyp2j8 APN 4 96503842 missense probably benign 0.06
IGL00418:Cyp2j8 APN 4 96444616 missense possibly damaging 0.85
IGL01577:Cyp2j8 APN 4 96479071 missense probably damaging 0.96
IGL01629:Cyp2j8 APN 4 96499603 missense probably damaging 1.00
IGL01928:Cyp2j8 APN 4 96470476 splice site probably benign
IGL01978:Cyp2j8 APN 4 96504009 splice site probably null
IGL02053:Cyp2j8 APN 4 96470654 missense probably damaging 1.00
IGL02500:Cyp2j8 APN 4 96470650 missense probably damaging 1.00
IGL02947:Cyp2j8 APN 4 96470578 missense probably damaging 1.00
cyprus UTSW 4 96499603 missense probably damaging 1.00
R0558:Cyp2j8 UTSW 4 96444634 missense probably benign 0.01
R0718:Cyp2j8 UTSW 4 96501196 missense probably benign
R1553:Cyp2j8 UTSW 4 96475557 missense probably benign
R1557:Cyp2j8 UTSW 4 96470476 splice site probably benign
R1632:Cyp2j8 UTSW 4 96447324 missense probably benign 0.02
R1708:Cyp2j8 UTSW 4 96499595 missense probably damaging 1.00
R2119:Cyp2j8 UTSW 4 96507201 missense probably benign
R2220:Cyp2j8 UTSW 4 96444625 missense probably benign 0.03
R3735:Cyp2j8 UTSW 4 96444599 missense probably damaging 1.00
R3736:Cyp2j8 UTSW 4 96444599 missense probably damaging 1.00
R4326:Cyp2j8 UTSW 4 96507329 missense probably benign 0.10
R4327:Cyp2j8 UTSW 4 96507329 missense probably benign 0.10
R4762:Cyp2j8 UTSW 4 96470649 missense probably damaging 1.00
R4901:Cyp2j8 UTSW 4 96479086 missense probably benign 0.16
R4960:Cyp2j8 UTSW 4 96507377 missense probably benign
R5260:Cyp2j8 UTSW 4 96501064 missense possibly damaging 0.65
R5562:Cyp2j8 UTSW 4 96470653 missense probably damaging 1.00
R5596:Cyp2j8 UTSW 4 96507341 missense probably benign 0.00
R5741:Cyp2j8 UTSW 4 96444643 missense probably benign 0.00
R5825:Cyp2j8 UTSW 4 96507214 missense probably benign 0.01
R5903:Cyp2j8 UTSW 4 96507277 missense possibly damaging 0.46
R6122:Cyp2j8 UTSW 4 96444640 missense probably benign
R6232:Cyp2j8 UTSW 4 96507190 missense possibly damaging 0.94
R6748:Cyp2j8 UTSW 4 96475545 missense probably benign 0.01
R6931:Cyp2j8 UTSW 4 96444781 splice site probably null
R7000:Cyp2j8 UTSW 4 96447351 missense probably benign 0.06
R7183:Cyp2j8 UTSW 4 96479181 missense probably damaging 0.97
R7186:Cyp2j8 UTSW 4 96475550 missense probably benign 0.00
R7348:Cyp2j8 UTSW 4 96444640 missense probably benign 0.00
R7575:Cyp2j8 UTSW 4 96470548 missense possibly damaging 0.63
R7648:Cyp2j8 UTSW 4 96499603 missense probably damaging 1.00
R7975:Cyp2j8 UTSW 4 96470539 missense possibly damaging 0.65
R7993:Cyp2j8 UTSW 4 96447219 critical splice donor site probably null
R8878:Cyp2j8 UTSW 4 96470570 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TTTCCACAACCCCGTGAAATG -3'
(R):5'- GAACCTATGAAGTTCCTGTCAAC -3'

Sequencing Primer
(F):5'- CCCGTGAAATGCCTACCTTTC -3'
(R):5'- TTCAGGTATGTTTCAGCTG -3'
Posted On2015-08-27