Incidental Mutation 'R3085:Wdr73'
ID 334555
Institutional Source Beutler Lab
Gene Symbol Wdr73
Ensembl Gene ENSMUSG00000025722
Gene Name WD repeat domain 73
Synonyms 2410008B13Rik, 1200011I23Rik
MMRRC Submission 040574-MU
Accession Numbers

Genbank: NM_028026; MGI: 1919218
Essential gene? Probably non essential (E-score: 0.203) question?
Stock # R3085 (G1)
Quality Score 63
Status Validated
Chromosome 7
Chromosomal Location 80890723-80901269 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) G to A at 80901242 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000026816] [ENSMUST00000026817] [ENSMUST00000119428]
AlphaFold Q9CWR1
Predicted Effect probably benign
Transcript: ENSMUST00000026816
SMART Domains Protein: ENSMUSP00000026816
Gene: ENSMUSG00000025722

DomainStartEndE-ValueType
WD40 67 112 8.52e1 SMART
Blast:WD40 162 204 3e-6 BLAST
Blast:WD40 208 254 3e-17 BLAST
WD40 263 304 2.57e0 SMART
WD40 314 364 8.91e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026817
SMART Domains Protein: ENSMUSP00000026817
Gene: ENSMUSG00000025723

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Bombesin 47 60 3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119428
SMART Domains Protein: ENSMUSP00000113407
Gene: ENSMUSG00000025723

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Bombesin 47 60 1.4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139990
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145923
Predicted Effect probably benign
Transcript: ENSMUST00000146402
SMART Domains Protein: ENSMUSP00000119974
Gene: ENSMUSG00000025722

DomainStartEndE-ValueType
Blast:WD40 66 111 3e-26 BLAST
Blast:WD40 182 228 4e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147589
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147154
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to contain multiple WD40 repeats. WD40 repeats are motifs that contain 40-60 amino acids, and usually end with Trp-Asp (WD). This protein is found in the cytoplasm during interphase, but accumulates at the spindle poles and astral microtubules during mitosis. Reduced expression of this gene results in abnormalities in the size and morphology of the nucleus. Mutations in this gene have been associated with Galloway-Mowat syndrome PMID: 25466283), which is a rare autosomal recessive disorder that affects both the central nervous system and kidneys. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI

All alleles(10) : Gene trapped(10)
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T A 8: 86,543,907 probably benign Het
Adrm1 T C 2: 180,174,301 probably null Het
Aldh18a1 T C 19: 40,574,369 I76V probably benign Het
Atp1b2 T C 11: 69,602,879 K125E possibly damaging Het
Cabyr T C 18: 12,750,966 V170A probably damaging Het
Cdh8 T C 8: 99,196,386 T293A probably benign Het
Cenpc1 A T 5: 86,037,617 V345D probably benign Het
Col4a3 A G 1: 82,651,258 E131G unknown Het
Col4a4 C T 1: 82,529,564 probably null Het
Creb3l1 G T 2: 91,995,444 probably null Het
Dhx9 T C 1: 153,465,699 D601G probably benign Het
Dyx1c1 T A 9: 72,972,406 N289K probably benign Het
Eml6 T C 11: 29,809,332 E807G probably damaging Het
Exog C A 9: 119,462,452 T241K probably benign Het
Eya1 T C 1: 14,274,090 D109G probably benign Het
Fam69a G T 5: 107,914,424 D28E probably damaging Het
Fat2 C T 11: 55,252,171 R4284H possibly damaging Het
Fbxw13 C A 9: 109,184,231 G130* probably null Het
Fcrl5 A G 3: 87,446,464 Y372C probably damaging Het
Gli3 T C 13: 15,660,941 S435P probably damaging Het
Gsg1l C T 7: 125,891,680 R284H probably benign Het
Havcr1 C T 11: 46,756,225 T162I probably damaging Het
Igdcc4 T C 9: 65,132,058 F947S probably damaging Het
Irx1 G T 13: 71,963,292 A66E probably damaging Het
Klf11 T C 12: 24,655,491 S315P probably benign Het
Kynu A G 2: 43,602,300 M190V probably benign Het
Lrp2 T C 2: 69,467,135 T3161A probably benign Het
Macrod1 G T 19: 7,196,494 A208S probably damaging Het
Mamdc2 G A 19: 23,310,932 H581Y possibly damaging Het
Megf8 T A 7: 25,349,019 Y1706N probably damaging Het
Mthfd1l G A 10: 4,090,007 R806H probably benign Het
Nags T A 11: 102,145,984 V133D probably damaging Het
Nrg3 C A 14: 38,370,949 D560Y probably damaging Het
Olfr1198 A G 2: 88,746,144 F248S probably damaging Het
Olfr1280 A G 2: 111,316,116 I212M probably benign Het
Olfr1313 C A 2: 112,071,975 G203* probably null Het
Olfr313 T C 11: 58,817,727 S240P probably damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pde6d T C 1: 86,547,526 probably null Het
Plekhf1 T C 7: 38,221,577 E189G probably benign Het
Ppm1b A T 17: 85,013,860 I477L probably benign Het
Rad51ap2 C A 12: 11,456,757 Q227K possibly damaging Het
Rnf125 T C 18: 20,977,730 V15A probably benign Het
Rnps1 C T 17: 24,412,419 probably benign Het
Robo1 A G 16: 73,002,010 I953V possibly damaging Het
Sash1 A T 10: 8,742,422 probably null Het
Smarcc2 T C 10: 128,488,159 probably benign Het
Stx12 T A 4: 132,857,361 E224V probably damaging Het
Sun1 T C 5: 139,235,601 V357A probably benign Het
Synpo2l T C 14: 20,662,180 D350G probably damaging Het
Tex15 A T 8: 33,574,885 N1448Y probably benign Het
Tfpi A G 2: 84,442,883 probably benign Het
Tktl2 T A 8: 66,513,206 M472K possibly damaging Het
Tmem40 T C 6: 115,741,615 D43G possibly damaging Het
Tshz2 T A 2: 169,883,951 C156S probably benign Het
Vmn2r101 T A 17: 19,588,815 probably null Het
Vmn2r85 T C 10: 130,425,212 M419V probably benign Het
Zc3hc1 C T 6: 30,374,764 probably null Het
Zfhx3 T C 8: 108,956,032 Y3368H unknown Het
Zfp263 G A 16: 3,749,716 E632K probably damaging Het
Zfp266 A G 9: 20,500,944 L111P probably damaging Het
Zfp626 T A 7: 27,818,162 S189R probably benign Het
Zfp772 T C 7: 7,203,700 R331G possibly damaging Het
Zkscan5 G A 5: 145,221,079 C797Y probably damaging Het
Other mutations in Wdr73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00710:Wdr73 APN 7 80893663 missense probably benign 0.01
IGL02183:Wdr73 APN 7 80893760 missense probably damaging 1.00
IGL03253:Wdr73 APN 7 80897946 missense probably benign 0.00
3-1:Wdr73 UTSW 7 80897959 missense possibly damaging 0.91
R0469:Wdr73 UTSW 7 80897950 nonsense probably null
R0507:Wdr73 UTSW 7 80891846 missense possibly damaging 0.88
R0510:Wdr73 UTSW 7 80897950 nonsense probably null
R1349:Wdr73 UTSW 7 80893252 missense probably damaging 1.00
R1782:Wdr73 UTSW 7 80891778 missense probably damaging 1.00
R1917:Wdr73 UTSW 7 80893333 missense probably benign 0.17
R4478:Wdr73 UTSW 7 80893221 missense probably benign 0.06
R4479:Wdr73 UTSW 7 80893221 missense probably benign 0.06
R4480:Wdr73 UTSW 7 80893221 missense probably benign 0.06
R4910:Wdr73 UTSW 7 80891708 missense probably damaging 0.97
R4925:Wdr73 UTSW 7 80893195 missense probably benign 0.00
R5046:Wdr73 UTSW 7 80892425 unclassified probably benign
R5286:Wdr73 UTSW 7 80891809 missense probably benign 0.04
R5842:Wdr73 UTSW 7 80891710 missense probably damaging 1.00
R6991:Wdr73 UTSW 7 80891856 missense probably benign 0.17
R7182:Wdr73 UTSW 7 80893678 missense possibly damaging 0.45
R7197:Wdr73 UTSW 7 80893198 missense probably benign 0.02
R7362:Wdr73 UTSW 7 80900703 missense probably damaging 1.00
R7771:Wdr73 UTSW 7 80893227 missense probably benign 0.13
R8558:Wdr73 UTSW 7 80898506 missense probably damaging 1.00
R8950:Wdr73 UTSW 7 80900383 missense probably benign 0.00
X0022:Wdr73 UTSW 7 80897951 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TTGCTTACAAAGGACCCAGAG -3'
(R):5'- CGATCCTGCTTGTAGCTGAC -3'

Sequencing Primer
(F):5'- CCAGAGTCCCAGAGCTAGAG -3'
(R):5'- AGCTGACATCGATGGATCTG -3'
Posted On 2015-08-31