Incidental Mutation 'R2859:Ism2'
ID 334560
Institutional Source Beutler Lab
Gene Symbol Ism2
Ensembl Gene ENSMUSG00000050671
Gene Name isthmin 2
Synonyms Thsd3, LOC217738
MMRRC Submission 040449-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2859 (G1)
Quality Score 39
Status Validated
Chromosome 12
Chromosomal Location 87278638-87299705 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 87299663 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 15 (M15V)
Ref Sequence ENSEMBL: ENSMUSP00000117108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000125733]
AlphaFold D3Z6A3
Predicted Effect unknown
Transcript: ENSMUST00000125733
AA Change: M15V
SMART Domains Protein: ENSMUSP00000117108
Gene: ENSMUSG00000050671
AA Change: M15V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 96 112 N/A INTRINSIC
TSP1 250 292 3.9e-7 SMART
AMOP 317 481 1.21e-75 SMART
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,281,314 Y1301C possibly damaging Het
Amfr A T 8: 94,005,214 N11K probably damaging Het
C87977 A G 4: 144,209,622 S23P probably benign Het
Cadm3 A G 1: 173,346,545 S34P possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh23 C T 10: 60,382,653 probably null Het
Ceacam1 T A 7: 25,474,017 I249F probably damaging Het
Cuzd1 C T 7: 131,316,134 V246M probably damaging Het
Ehd2 A T 7: 15,964,129 V61E probably damaging Het
Fam71b T C 11: 46,405,212 I137T probably damaging Het
Fibin C T 2: 110,362,197 R200H probably damaging Het
Fmo9 A C 1: 166,673,667 F237C probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Iqgap3 C A 3: 88,107,596 S873* probably null Het
Itk T G 11: 46,344,835 probably benign Het
Mastl C A 2: 23,139,967 C249F probably damaging Het
Mink1 T C 11: 70,612,508 V1143A probably damaging Het
Mrgprb4 T A 7: 48,198,336 R281S possibly damaging Het
Mthfd1 T C 12: 76,288,925 Y258H probably damaging Het
Ntmt1 A G 2: 30,822,365 H140R probably damaging Het
Olfr139 C T 11: 74,044,827 G149D possibly damaging Het
Olfr311 T A 11: 58,841,882 V256E probably benign Het
Olfr340 T C 2: 36,453,130 S182P probably benign Het
Olfr401 T C 11: 74,121,982 I231T probably damaging Het
Parm1 A G 5: 91,594,306 T178A possibly damaging Het
Patl1 T C 19: 11,923,831 F282L probably damaging Het
Phospho2 T C 2: 69,795,851 V117A possibly damaging Het
Ppp4r3a T C 12: 101,042,647 probably null Het
Rbm17 A G 2: 11,590,704 F230S possibly damaging Het
Robo3 C A 9: 37,428,104 G196* probably null Het
Samhd1 A G 2: 157,106,229 probably null Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Thbs4 A G 13: 92,790,708 F91S probably benign Het
Trim34b A T 7: 104,336,232 N358I probably benign Het
Ulk1 A G 5: 110,794,629 L255P probably damaging Het
Vmn2r104 T A 17: 20,048,193 I5F possibly damaging Het
Vrk2 C A 11: 26,483,324 S286I possibly damaging Het
Zswim3 T C 2: 164,820,389 L263P probably damaging Het
Other mutations in Ism2
AlleleSourceChrCoordTypePredicted EffectPPH Score
Aedes UTSW 12 87280195 missense probably damaging 1.00
canal UTSW 12 87280061 missense probably damaging 1.00
narrows UTSW 12 87285339 missense probably damaging 1.00
panamin UTSW 12 87286884 splice site probably null
Zone UTSW 12 87299663 missense unknown
PIT4243001:Ism2 UTSW 12 87287058 missense probably benign 0.00
R0544:Ism2 UTSW 12 87285339 missense probably damaging 1.00
R0747:Ism2 UTSW 12 87285398 splice site probably benign
R2258:Ism2 UTSW 12 87280074 missense possibly damaging 0.92
R3423:Ism2 UTSW 12 87287097 missense probably benign 0.00
R3425:Ism2 UTSW 12 87287097 missense probably benign 0.00
R4115:Ism2 UTSW 12 87287031 missense probably benign 0.02
R4713:Ism2 UTSW 12 87285027 splice site silent
R4769:Ism2 UTSW 12 87299581 missense probably benign 0.06
R5313:Ism2 UTSW 12 87279762 missense probably damaging 1.00
R5857:Ism2 UTSW 12 87280061 missense probably damaging 1.00
R5984:Ism2 UTSW 12 87287035 missense possibly damaging 0.77
R6389:Ism2 UTSW 12 87282371 missense possibly damaging 0.49
R6838:Ism2 UTSW 12 87280201 missense probably benign 0.23
R7019:Ism2 UTSW 12 87299663 missense unknown
R7358:Ism2 UTSW 12 87280040 missense probably damaging 1.00
R7427:Ism2 UTSW 12 87286995 missense possibly damaging 0.76
R7428:Ism2 UTSW 12 87286995 missense possibly damaging 0.76
R7777:Ism2 UTSW 12 87286884 splice site probably null
R7824:Ism2 UTSW 12 87279860 missense probably damaging 1.00
R7973:Ism2 UTSW 12 87286995 missense possibly damaging 0.76
R9006:Ism2 UTSW 12 87280195 missense probably damaging 1.00
R9274:Ism2 UTSW 12 87285053 nonsense probably null
R9306:Ism2 UTSW 12 87287052 missense probably benign 0.45
Z1177:Ism2 UTSW 12 87280035 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGAGTGTAAACTCCTGCG -3'
(R):5'- TTTCCCGGGACAGGAATTC -3'

Sequencing Primer
(F):5'- TAAACTCCTGCGGGCTCAGTG -3'
(R):5'- ACAGGAATTCGCTTGGGGC -3'
Posted On 2015-09-02