Incidental Mutation 'R3546:Etaa1'
ID334561
Institutional Source Beutler Lab
Gene Symbol Etaa1
Ensembl Gene ENSMUSG00000016984
Gene NameEwing tumor-associated antigen 1
Synonyms5730466H23Rik
MMRRC Submission 040665-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3546 (G1)
Quality Score29
Status Validated
Chromosome11
Chromosomal Location17938756-17953875 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) A to G at 17953823 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000075957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076661]
Predicted Effect probably benign
Transcript: ENSMUST00000076661
SMART Domains Protein: ENSMUSP00000075957
Gene: ENSMUSG00000016984

DomainStartEndE-ValueType
low complexity region 52 74 N/A INTRINSIC
Pfam:ETAA1 79 865 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148496
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik A G 3: 88,693,136 probably benign Het
AA986860 A G 1: 130,741,189 probably benign Het
Bves A G 10: 45,354,811 R293G probably damaging Het
Ceacam1 T C 7: 25,471,914 N375S probably benign Het
Celf3 T G 3: 94,488,538 C304G probably damaging Het
Clcc1 T A 3: 108,668,113 C169S probably benign Het
Cyth1 A G 11: 118,192,436 V46A probably damaging Het
Ddx23 G A 15: 98,650,732 T365M probably damaging Het
Fap A C 2: 62,519,011 L478R probably damaging Het
Golga7b T C 19: 42,267,071 M129T possibly damaging Het
Hdac7 G T 15: 97,808,009 Q361K probably damaging Het
Itk A G 11: 46,355,848 L181P probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Lrp1b A T 2: 40,600,288 L287H probably damaging Het
Mei1 A G 15: 82,098,042 Y677C probably damaging Het
Mslnl T C 17: 25,744,969 V424A probably damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Nlrp6 T G 7: 140,926,769 V849G probably benign Het
Olfr524 A G 7: 140,202,101 I223T probably damaging Het
Pdilt C A 7: 119,500,488 E186* probably null Het
Ppp1r27 T A 11: 120,550,685 I90F probably damaging Het
Reln A G 5: 22,227,600 V134A possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc16a7 T A 10: 125,294,700 K39* probably null Het
Sult6b1 G A 17: 78,906,907 T29I probably benign Het
Tbc1d1 G A 5: 64,286,007 R523Q probably damaging Het
Ttn T A 2: 76,745,106 I25148F probably damaging Het
Ush1g T A 11: 115,318,897 H157L probably damaging Het
Utp20 T C 10: 88,782,689 K1150E probably damaging Het
Vmn1r7 A G 6: 57,024,849 I142T possibly damaging Het
Other mutations in Etaa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Etaa1 APN 11 17947825 nonsense probably null
IGL00555:Etaa1 APN 11 17947535 missense probably damaging 1.00
IGL01098:Etaa1 APN 11 17946059 missense probably damaging 0.99
IGL01100:Etaa1 APN 11 17952576 critical splice donor site probably null
IGL01312:Etaa1 APN 11 17945909 missense probably damaging 1.00
IGL01391:Etaa1 APN 11 17946005 missense probably damaging 1.00
IGL01607:Etaa1 APN 11 17953637 missense probably benign 0.00
IGL02066:Etaa1 APN 11 17946687 missense probably benign
R0401:Etaa1 UTSW 11 17947514 missense probably damaging 1.00
R0413:Etaa1 UTSW 11 17946350 nonsense probably null
R0790:Etaa1 UTSW 11 17946051 missense probably benign 0.00
R1442:Etaa1 UTSW 11 17947201 missense probably benign 0.19
R1447:Etaa1 UTSW 11 17946625 missense possibly damaging 0.92
R1647:Etaa1 UTSW 11 17946492 missense probably damaging 0.99
R1945:Etaa1 UTSW 11 17947233 missense probably damaging 0.96
R1996:Etaa1 UTSW 11 17952671 missense probably damaging 1.00
R2211:Etaa1 UTSW 11 17952686 nonsense probably null
R2338:Etaa1 UTSW 11 17945605 critical splice donor site probably null
R3027:Etaa1 UTSW 11 17947886 missense probably damaging 1.00
R4118:Etaa1 UTSW 11 17946180 missense probably benign 0.18
R4156:Etaa1 UTSW 11 17940281 missense probably damaging 1.00
R4657:Etaa1 UTSW 11 17946964 missense possibly damaging 0.81
R4882:Etaa1 UTSW 11 17946174 missense probably benign 0.10
R4914:Etaa1 UTSW 11 17946532 missense probably benign 0.05
R4978:Etaa1 UTSW 11 17946581 missense probably damaging 0.99
R5202:Etaa1 UTSW 11 17947853 missense probably damaging 1.00
R5384:Etaa1 UTSW 11 17947539 missense probably damaging 1.00
R5584:Etaa1 UTSW 11 17947406 missense possibly damaging 0.72
R6303:Etaa1 UTSW 11 17947505 missense probably damaging 1.00
R6304:Etaa1 UTSW 11 17947505 missense probably damaging 1.00
R6351:Etaa1 UTSW 11 17947188 missense possibly damaging 0.95
R6391:Etaa1 UTSW 11 17946833 missense probably benign 0.04
R6685:Etaa1 UTSW 11 17953582 missense probably benign 0.40
R6705:Etaa1 UTSW 11 17945639 missense probably benign 0.02
R6807:Etaa1 UTSW 11 17952680 missense probably benign
R6863:Etaa1 UTSW 11 17953794 start codon destroyed probably benign 0.01
R6985:Etaa1 UTSW 11 17946108 missense probably damaging 0.99
R7129:Etaa1 UTSW 11 17940339 missense possibly damaging 0.92
R7429:Etaa1 UTSW 11 17940281 missense probably damaging 1.00
Z1088:Etaa1 UTSW 11 17946465 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TTCAGAAAAGGCCCGGTTTAC -3'
(R):5'- AGAAAACTCCTGTTTCCTCAGC -3'

Sequencing Primer
(F):5'- TCTGCACCGCCAGGCTC -3'
(R):5'- TTCCTCAGCCCTGGCCG -3'
Posted On2015-09-02