Incidental Mutation 'R3546:Ush1g'
ID334562
Institutional Source Beutler Lab
Gene Symbol Ush1g
Ensembl Gene ENSMUSG00000045288
Gene NameUSH1 protein network component sans
Synonymsjs, Sans
MMRRC Submission 040665-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R3546 (G1)
Quality Score68
Status Validated
Chromosome11
Chromosomal Location115315192-115322041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115318897 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 157 (H157L)
Ref Sequence ENSEMBL: ENSMUSP00000099326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055490] [ENSMUST00000103037] [ENSMUST00000106544]
Predicted Effect probably benign
Transcript: ENSMUST00000055490
SMART Domains Protein: ENSMUSP00000062109
Gene: ENSMUSG00000050201

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 62 81 N/A INTRINSIC
Pfam:Otopetrin 102 225 1e-18 PFAM
Pfam:Otopetrin 214 451 5.5e-20 PFAM
Pfam:Otopetrin 479 550 8.9e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103037
AA Change: H157L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099326
Gene: ENSMUSG00000045288
AA Change: H157L

DomainStartEndE-ValueType
ANK 31 60 1.83e-3 SMART
ANK 64 93 8.07e-5 SMART
ANK 97 126 6.26e-2 SMART
low complexity region 159 190 N/A INTRINSIC
PDB:3PVL|B 295 368 3e-30 PDB
SAM 385 449 1.34e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106544
SMART Domains Protein: ENSMUSP00000102154
Gene: ENSMUSG00000050201

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 62 81 N/A INTRINSIC
Pfam:Otopetrin 102 450 7.9e-54 PFAM
Pfam:Otopetrin 476 550 2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139466
Meta Mutation Damage Score 0.2523 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: This gene encodes a protein that contains three ankyrin domains, a class I PDZ-binding motif and a sterile alpha motif. The encoded protein interacts with harmonin, which is associated with Usher syndrome type 1C. This protein plays a role in the development and maintenance of the auditory and visual systems and functions in the cohesion of hair bundles formed by inner ear sensory cells. Mutations in this gene are associated with combined auditory and vision loss. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutant homozygotes exhibit hyperactivity, head-tossing, circling behavior and profound deafness. Structurally, mutants display disorganized stereocilia of outer ear hair cells and degeneration of inner ear neuroepithelia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik A G 3: 88,693,136 probably benign Het
AA986860 A G 1: 130,741,189 probably benign Het
Bves A G 10: 45,354,811 R293G probably damaging Het
Ceacam1 T C 7: 25,471,914 N375S probably benign Het
Celf3 T G 3: 94,488,538 C304G probably damaging Het
Clcc1 T A 3: 108,668,113 C169S probably benign Het
Cyth1 A G 11: 118,192,436 V46A probably damaging Het
Ddx23 G A 15: 98,650,732 T365M probably damaging Het
Etaa1 A G 11: 17,953,823 probably benign Het
Fap A C 2: 62,519,011 L478R probably damaging Het
Golga7b T C 19: 42,267,071 M129T possibly damaging Het
Hdac7 G T 15: 97,808,009 Q361K probably damaging Het
Itk A G 11: 46,355,848 L181P probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Lrp1b A T 2: 40,600,288 L287H probably damaging Het
Mei1 A G 15: 82,098,042 Y677C probably damaging Het
Mslnl T C 17: 25,744,969 V424A probably damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Nlrp6 T G 7: 140,926,769 V849G probably benign Het
Olfr524 A G 7: 140,202,101 I223T probably damaging Het
Pdilt C A 7: 119,500,488 E186* probably null Het
Ppp1r27 T A 11: 120,550,685 I90F probably damaging Het
Reln A G 5: 22,227,600 V134A possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc16a7 T A 10: 125,294,700 K39* probably null Het
Sult6b1 G A 17: 78,906,907 T29I probably benign Het
Tbc1d1 G A 5: 64,286,007 R523Q probably damaging Het
Ttn T A 2: 76,745,106 I25148F probably damaging Het
Utp20 T C 10: 88,782,689 K1150E probably damaging Het
Vmn1r7 A G 6: 57,024,849 I142T possibly damaging Het
Other mutations in Ush1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01961:Ush1g APN 11 115318535 missense probably benign 0.00
IGL02055:Ush1g APN 11 115318099 missense possibly damaging 0.94
R0833:Ush1g UTSW 11 115318868 missense possibly damaging 0.71
R1435:Ush1g UTSW 11 115318468 missense probably damaging 1.00
R1969:Ush1g UTSW 11 115318454 missense probably damaging 1.00
R1971:Ush1g UTSW 11 115318454 missense probably damaging 1.00
R4789:Ush1g UTSW 11 115318640 missense probably damaging 1.00
R5074:Ush1g UTSW 11 115318297 missense possibly damaging 0.94
R5882:Ush1g UTSW 11 115318542 missense probably damaging 0.98
R7540:Ush1g UTSW 11 115318573 missense probably benign 0.01
R8841:Ush1g UTSW 11 115319181 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTCCTCAGAGACCTTGAAG -3'
(R):5'- TGCCTGGACAATGACTACCAC -3'

Sequencing Primer
(F):5'- TTGAAGGTGCCCTCGCC -3'
(R):5'- ACACGCCACTGGACATGG -3'
Posted On2015-09-02