Incidental Mutation 'R2858:Ppp1r1b'
ID334567
Institutional Source Beutler Lab
Gene Symbol Ppp1r1b
Ensembl Gene ENSMUSG00000061718
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 1B
SynonymsDARPP-32, Darpp32
MMRRC Submission 040448-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R2858 (G1)
Quality Score20
Status Validated
Chromosome11
Chromosomal Location98348404-98357796 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 98355319 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018311] [ENSMUST00000078694] [ENSMUST00000137634] [ENSMUST00000150762]
Predicted Effect probably benign
Transcript: ENSMUST00000018311
SMART Domains Protein: ENSMUSP00000018311
Gene: ENSMUSG00000018167

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
Pfam:MENTAL 48 214 1.1e-65 PFAM
START 240 445 4.43e-67 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078694
SMART Domains Protein: ENSMUSP00000077760
Gene: ENSMUSG00000061718

DomainStartEndE-ValueType
Pfam:DARPP-32 2 183 6.8e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133700
Predicted Effect probably benign
Transcript: ENSMUST00000137634
SMART Domains Protein: ENSMUSP00000123528
Gene: ENSMUSG00000061718

DomainStartEndE-ValueType
Pfam:DARPP-32 1 143 7.4e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147415
Predicted Effect probably benign
Transcript: ENSMUST00000150762
SMART Domains Protein: ENSMUSP00000121147
Gene: ENSMUSG00000061718

DomainStartEndE-ValueType
Pfam:DARPP-32 1 143 7.4e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155063
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: This gene encodes a bifunctional signal transduction molecule. Dopaminergic and glutamatergic receptor stimulation regulates its phosphorylation and function as a kinase or phosphatase inhibitor. As a target for dopamine, this gene may serve as a therapeutic target for neurologic and psychiatric disorders in humans. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit elevated substance P-like immunoreactivity and deficits in responses to dopamine, cocaine, ethanol, and antipsychotic drugs. Abnormalities in striatal function were also noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik T A 5: 107,545,801 F95I probably benign Het
5430403G16Rik T C 5: 109,675,953 T544A probably benign Het
Abcg5 A G 17: 84,670,220 probably null Het
Amfr A T 8: 94,005,214 N11K probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh23 C T 10: 60,382,653 probably null Het
Chd4 A G 6: 125,104,886 K481R probably damaging Het
Cyp2a22 T C 7: 26,934,262 Y341C probably damaging Het
Ddb2 T C 2: 91,216,677 T338A probably damaging Het
Fat2 A G 11: 55,283,773 V2038A possibly damaging Het
Fbxo36 A G 1: 84,896,595 K104R probably benign Het
Fmo9 A C 1: 166,673,667 F237C probably damaging Het
Helz G A 11: 107,672,927 probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Ifit1bl1 A T 19: 34,594,322 I245K probably benign Het
Ighv1-22 T C 12: 114,746,298 D109G probably damaging Het
Kcnk10 T C 12: 98,435,289 R376G possibly damaging Het
Lrrc66 T A 5: 73,607,303 E799V probably benign Het
Lrrc7 T A 3: 158,161,725 N793I probably damaging Het
Nexn C T 3: 152,248,043 E247K probably damaging Het
Ntmt1 A G 2: 30,822,365 H140R probably damaging Het
Olfr139 C T 11: 74,044,827 G149D possibly damaging Het
Olfr311 T A 11: 58,841,882 V256E probably benign Het
Olfr743 T A 14: 50,533,440 N9K probably benign Het
Pask A G 1: 93,321,651 Y676H probably benign Het
Polq T A 16: 37,062,753 F1760I possibly damaging Het
Psmf1 A G 2: 151,729,536 L169P probably damaging Het
Rcbtb1 T A 14: 59,221,412 probably null Het
S1pr4 C A 10: 81,499,239 A134S probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc24a1 T C 9: 64,949,332 I98V unknown Het
Slc6a21 G A 7: 45,280,528 A147T possibly damaging Het
Sycp3 A G 10: 88,467,372 E166G probably damaging Het
Uhrf1bp1 G T 17: 27,885,462 R494L probably damaging Het
Vmn2r82 T A 10: 79,381,256 I474N probably damaging Het
Other mutations in Ppp1r1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Ppp1r1b APN 11 98350566 splice site probably null
IGL01979:Ppp1r1b APN 11 98356840 missense probably damaging 0.99
IGL02455:Ppp1r1b APN 11 98350569 missense probably damaging 1.00
IGL02818:Ppp1r1b APN 11 98351270 missense possibly damaging 0.92
R1965:Ppp1r1b UTSW 11 98355363 missense probably damaging 1.00
R4893:Ppp1r1b UTSW 11 98355344 missense possibly damaging 0.69
R5514:Ppp1r1b UTSW 11 98355402 missense probably damaging 1.00
R6315:Ppp1r1b UTSW 11 98355390 missense probably damaging 1.00
R6813:Ppp1r1b UTSW 11 98349176 critical splice donor site probably null
R7426:Ppp1r1b UTSW 11 98355479 missense probably damaging 1.00
R7524:Ppp1r1b UTSW 11 98350894 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- GCGTTCTCGGAACAGCTTAAGAG -3'
(R):5'- TTCTGGAAGAGCCACCACAC -3'

Sequencing Primer
(F):5'- ATGTGATTAAAAATGTACGCCTGTGG -3'
(R):5'- TGACCCACGGTAGCAGGAAC -3'
Posted On2015-09-03